Development of SCAR marker for Specific Detection of Trichoderma harzanium and Trichoderma viride

H. J. Parmar¹, M. M. Hassan^{2, 3,} , N. P. Bodar¹, H .N. Lakhani¹, V. V. Umrania⁴ and B. A. Golakiya¹

¹Department of Biotechnology, College of Agriculture, Junagadh Agriculture University, Junagadh -362001, India

²Scientific Research Center, Biotechnology and Genetic Engineering Unit, Taif University, KSA

³Genetics Department, Faculty of Agriculture, Minufiya University, Egypt

⁴Microbiology Dept, MVM Science and Home Science College, Saurashtra University, Rajkot -360001, India

Cite this paper:
H. J. Parmar, M. M. Hassan, N. P. Bodar, H .N. Lakhani, V. V. Umrania and B. A. Golakiya. Development of SCAR marker for Specific Detection of Trichoderma harzanium and Trichoderma viride. American Journal of Microbiological Research. 2015; 3(1):45-49. doi: 10.12691/ajmr-3-1-7

Abstract

Trichoderma have been used as biological control agents against soil borne plant pathological fungi such as S. rolfsii. On this day molecular based techniques has been developed to detect T. harzanium using a fungus-specific marker derived from genomic DNA. An amplified RAPD product of 220 bp and 900 bp obtained in T. harzanium (NBAII Th 1) and T. viride (NBAII Tv 2) isolates, respectively. These two RAPD products were obtained using two random primers OPA-16 for harzanium (NBAII Th 1) isolate and OPC-05 for T. viride (NBAII Tv 2), thin RAPD products were sequenced. Based on sequences, one primers were designed, out of which a primer pair HAR220FP5 (CTTTTGGTTTGACACGGTTCT and HAR220RP5 (AAGCTTTGAAGTTGCGAGGA) amplified a sequence of 220 bp. and VIRI900FP7 (TACGCTCCAGGCTACCACTT) VIRI900RP7 (GAGATGAGCTCCTTGCTGCT) amplified a sequence of 900 bp. which was specific to T. harzianum and T. viride, respectively. The specificity of the marker when tested against six isolates of Trichoderma species showed a specific band of 220 bp. only in T. harzanium and a specific band of 900 bp. only in T.viride with the optimized PCR parameters. This sequence characterized amplified region (SCAR) marker was sensitive and could detect small quantities of Trichoderma DNA as low as 25 to 30 ng with high efficiency. This marker could also clearly distinguish T. harzianum and T. viride from other isolates of Trichoderma.

Keywords:
T. harzanium T. viride random amplified polymorphic DNA (RAPD) sequence characterized amplified region (SCAR) marker.

This work is licensed under a Creative Commons Attribution 4.0 International License. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

References:

[1]	Knudsen IMB, Jensen B, Jensen DF, Hockenhull J (1996) Occurrence of Gliocladium roseum on barley roots in sand and field soil. Kluwer Academic Publishers, Netherlands.
[2]	Seaby DA (1996) Differentiation of Trichoderma taxa associated with mushroom production. Plant Pathol 45: 905-912.
[3]	Shahid M, Singh A, Srivastava M, Srivastava DK (2014) Molecular Characterization of Trichoderma viride isolated from rhizospheric soils of uttar pradesh based on rDNA markers and analysis of their PCR-ISSR profiles. J Mol Biomark Diagn 5: 169.
[4]	Ospina-Giraldo MD, Royse DJ, Chen X, Romaine CP (1999) Molecular Phylogenetic Analyses of Biological Control Strains of Trichoderma harzianum and Other Biotypes of Trichoderma spp. Associated with Mushroom Green Mold. Phytopathology 89: 308-313.
[5]	Hassan M M (2014). Influence of protoplast fusion between Trichoderma spp. enhances extracellular enzymes and antagonistic activity against some soil pathogens. Biotechnology and biotechnological equipments, 28: 1014-1023.
[6]	Hassan M M, A Gaber and E I. El-Hallous (2014) Molecular and Morphological Characterization of Trichoderma harzianum from different Egyptian Soils, Wulfenia Journal, 21: 80-96.
[7]	Hermosa, M. R., Grondona, I., Iturriaga, E. A., Dia-MinGuez, Castro, C., Monte, E. and Garcia-Acha, I. 2000. Molecular characterization and identification of biocontrol isolates of Trichoderma spp. Applied and Env. Microbiology. 66 (5): 1890-1898.
[8]	Venkateswarulu, R., Reddi Kumar, M., Eswara Reddy, N. P. and Sudhakar, P. 2008. Molecular characterization of Trichoderma spp. used against Fusarium wilt with PCR based RAPD and ITS-PCR. J. Mycology and Plant Pathology. 38 (3): 559-563.
[9]	Abbasi P. A., Miller S. A., Mealia T., Hoitink H. A. J., and Kim J. M. (1999). Precise detection and tracing of Trichoderma hamatum 382 in compost amended potting mixes by using molecular markers. Appl. Environ. Microbiol. 12: 5421-5426.
[10]	Lecomte P, Peros JP, Blancard D, Bastien N, Delye C (2000). PCR assays that identify the grapevine dieback fungus Eutypa lata. Appl. Environ. Microbiol. 66: 4475-4480.
[11]	Li KN, Rouse DI, Eyestone EJ, German TL (1999). The generation of specific DNA primers using random amplified polymorphic DNA and its application to Verticillium dahliae. Mycol. Res. 103: 1361-1368.
[12]	Schilling AG, Moller EM, Geiger HH (1996). Polymerase chainreactionbased assays for species-specific detection of Fusarium culmorum, F. graminearum, and F. avenaceum. Phytopathol. 86: 515-522.
[13]	Watanabe N (1984) Bulletin of Faculty of Agriculture, Maiji University, Japan 66: 45.
[14]	Doyle J. J, Doyle J. L (1987) .A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull .19: 11-15.
[15]	Shalini 1, Narayan, K. P. 1, Lata1 and Kotasthane, A. S. (2006). Genetic relatedness among Trichoderma species inhibiting a pathogenic fungi Rhizoctonia solani. African Journal of Biotechnology Vol. 5 (8), pp. 580-584.
[16]	Sneath, P. H. A. and Sokal, R. R. (1973). Numerical Taxonomy: The Principles and Pratice of Numerical Classification. San Francisco: Freeman, 573 pp.
[17]	Lieckfeldt, G.J. Samuels, H.I. Nirenberg, O. Petrini A. (1999). morphological and molecular perspective of Trichoderma viride: is it one or two species Appl. Environ. Microbiol. 65: 2418-2428.
[18]	Kandoliya U.K. and D. N. Vakharia (2013) Antagonistic effect of Pseudomonas fluorescens against fusrium oxysporum f.sp. Ciceri causing wilt in chickpea. Legume Research., 36 (6) 569-575.
[19]	Zimand, G., Valinsky, L., Elad, Y., Chet, I., Manualis, S. (1994). Use of RAPD procedure for the identification of Trichoderma species. Mycol. Res. 98, 531-534.
[20]	Bulat, S. A., Lubeck, M., Mironenko, N. V., Jensen, D. F., Lubeck, P. S. (1998). UPPCR analysis and ITS1 ribotyping of Trichoderma and Gliocladium fungi. Mycol. 102: 933-943.
[21]	Cumagun CJR, Hockenhull J, Lübeck M (2000) Characterization of Trichoderma isolates from Philippine rice fields by UP-PCR and rDNA-ITSI analysis: identification of UP-PCR markers. Journal of Phytopathology 148: 109-115.
[22]	Naeimi, S. (2010). Development of a specific molecular marker for detection of the most effective Trichoderma strain against Than at ephoruscucumeris, the causal agent of rice sheath blight disease. Ph.D thesis, Faculty of Agriculture, University of Tehran, Karaj, Iran.