American Journal of Microbiological Research

ISSN (Print): 2328-4129

ISSN (Online): 2328-4137



Development of an in Vitro Novel Device that Simulates the Real Life of the Biofilm Formation on Catheters under both Static and Continuous Fluid Flow Systems

1Department of Microbiology, Immunology and Biotechnology, Faculty of Pharmacy and Biotechnology, German University in Cairo, GUC, New Cairo City, Egypt

American Journal of Microbiological Research. 2015, 3(1), 25-32
DOI: 10.12691/ajmr-3-1-4
Copyright © 2015 Science and Education Publishing

Cite this paper:
Mohamed El-Azizi. Development of an in Vitro Novel Device that Simulates the Real Life of the Biofilm Formation on Catheters under both Static and Continuous Fluid Flow Systems. American Journal of Microbiological Research. 2015; 3(1):25-32. doi: 10.12691/ajmr-3-1-4.

Correspondence to: Mohamed  El-Azizi, Department of Microbiology, Immunology and Biotechnology, Faculty of Pharmacy and Biotechnology, German University in Cairo, GUC, New Cairo City, Egypt. Email:


Biofilm model systems are essential to explore the development and the nature of the microbial community within the biofilm as well as the mechanism of their resistance. The aim of this work is to develop a simple in vitro novel device which mimics the real life of the biofilm formation and could be modulated to contain most catheter and tubes and readily allows biofilm formation under different experimental conditions. Two clinical isolates, Staphylococcus epidermidis and Candida albicans, were used to validate the device. The viability of the microorganisms within the biofilm was demonstrated quantitatively by viable count and semi-quantitively by using Scanning Electron Microscope and Confocal Scanning Laser Microscope. The shear stress on the inner and outer surfaces of the catheter was determined at different flow rates of the culture medium. The presented device supports biofilm formation of the tested microorganisms under static and dynamic fluid flow systems. The results are comparable to that of other biofilm models. The number of cells contained in the biofilm under static system was significantly higher than that of the biofilm which formed under dynamic system for both microorganisms. For S. epidermidis, the log value of the number of cells contained in the biofilm under static system was 6.41 ± 0.22 compared to 5.18 ±0.13 of the biofilm which formed under continuous fluid flow system (p < 0.001). For C. albicans, the log value of the number of adherent cells was 6.44 ± 38 and 5.47 ± 0.05 respectively (p = 0.012). The presented well suited to study the real life of the biofilm formation by microorganisms. It enables the formation of a reproducible biofilm of bacteria and yeast on the catheter surface in both static and dynamic systems and its design permits low laminar flow system.



[1]  Prosser, P.L., Taylor, D., Dix B.A. and Cleeland, R, “Method of evaluating effects of antibiotics on bacterial biofilm,” Antimicrob Agents Chemother, 31(10). 1502-1506. Oct.1987.
[2]  El-Azizi, M., Rao, S., Kanchanapoom, T. and Khardori N, “In vitro activity of vancomycin, quinupristin/dalfopristin, and linezolid against intact and disrupted biofilms of staphylococci,” Ann Clin Microbiol Antimicrob, 4(2). Jan. 2005 [Online].
[3]  Johnson, G.M., Lee, D.A., Regelmann, W.E., Gray, E.D., Peters, G. and Quie, P.G, “Interference with granulocyte function by Staphylococcus epidermidis slime,” Infect Immun, 54(1). 13-20. Oct.1986.
[4]  Coenye, T. and Nelis, H.J, “In vitro and in vivo model systems to study microbial biofilm formation,” J Microbiol Methods, 83(2). 89-105. Nov.2010.
[5]  Pavarina, A.C., Dovigo, L.N., Sanita, P.V., Machada, A. L., Giampaolo, E.T. and Vergani, C.E, Biofilm formation: development and properties, Nova Science Publishers Inc., New York, 2011, 125-162.
Show More References
[6]  Andes, D., Nett, J., Oschel, P., Albrecht, R., Marchillo, K. and Pitula, A, “Development and characterization of an in vivo central venous catheter Candida albicans biofilm model,” Infect Immun, 72(10). 6023-6031.Oct.2004
[7]  Freire, M.O., Sedghizadeh, P.P., Schaudinn, C., Gorur, A., Downey, J.S., Choi, J.H., Chen, W., Kook, J.K., Chen, C.,Goodman, S.D. and Zadeh, H.H, “Development of an animal model for Aggregatibacter Actinomycetemcomitans biofilm-mediated oral osteolytic infection: A preliminary study,” J Periodontol, 82(5). 778-789. May 2011.
[8]  Williams, D.L. and Costerton, J.W, “Using biofilms as initial inocula in animal models of biofilm-related infections,” J Biomed Mater Re, 100(4). 1163-1169.May 2012.
[9]  Harraghyi, N., Seiler, S., Jacobs, K., Hannig, M., Menger, M.D. and Herrmann, M, “Advances in in vitro and in vivo models for studying the staphylococcal factors involved in implant infections,” The International Journal of Artificial Organs, 29(4). 368-378. Apr. 2006.
[10]  Christensen, G.D., Simpson, W.A., Younger, J.J., Baddour, L.M., Barrett, F.F. and Melton, D.M, “Adherence of coagulase negative staphylococci to plastic tissue culture plates: A quantitative model for the adherence of staphylococci to medical devices,” J Clin Microbiol, 22(6). 996-1006. Dec. 1985.
[11]  Stepanovic, S., Vukovic, D., Dakic, I., Savic, B. and Svabic-Vlahovic, M, “A modified microtiter-plate test for quantification of staphylococcal biofilm formation,” J Microbiol Methods, 40(2). 175-179. Apr. 2000.
[12]  Mack, D., Siemssen, N. and Laufs, R, “Parallel induction by glucose of adherence and a polysaccharide antigen specific for plastic-adherent Staphylococcus epidermidis: Evidence for functional relation to intercellular adhesion,” Infect. Immunol, 60(5). 2048-2057. May 1992.
[13]  McCoy, W.F., Bryers, J.D., Robbins, J. and Costerton, J.W, “Observations in fouling biofilm formation,” Can J Microbiol, 27 (9).910-917. Sep. 1981.
[14]  Leung K.P., Crowel, T.D., Abercrombie, I.J., Molina, C.M., Bradshaw, C.J., Jensen, C.L., Luo, Q. and Thompson, G.A, “Control of oral biofilm formation by an antimicrobial decapeptide,” J Dent Res, 2005, 84(12). 1172-77. Dec. 2005.
[15]  Chin, M.Y., Busscher, H.J., Evans, R., Noar, J. and Pratten, J, “Early biofilm formation and the effects of antimicrobial agent in orthodontic bonding materials in a parallel plate flow chamber,” Eur J Orthod, 28(1). 1-7. Feb.2006.
[16]  Rieu, A., Briandet, R., Habiana, O., Garmyn, D., Guzzo, J. and Piveteau, P, “Listeria monocytogenes EGD-e biofilms: no mushroom but a network of knitted chains,” Appl Environ Microbiol, 74(14). 4491-4497. Jul. 2008.
[17]  El-Azizi, M, “Enhancement of the in vitro activity of amphotericin B against the biofilms of non-albicans Candida spp. by rifampicin and doxycycline,” J Med Microbiol, 56(Pt5). 645-649. May 2007.
[18]  Marrie, J. and Casterton, W, “Scanning and transmission electron microscopy of in situ bacterial colonization of intravenous and intraatrial catheters,” J Clin Microbiol, 19(5). 687-693. May 1984.
[19]  Cengel, Y.A. and Cimbala, J.M, Fluid Mechanics: Fundamentals and Applications. 1st edition, McGraw Hill, New York, 2006, 322-325.
[20]  McBain, A.J, “In vitro biofilm models: An overview,” Adv Appl Microbiol, 69. 99-132. 2009.
[21]  Wenzel, R.P. and Edmond, M.B, “The impact of hospital-acquired bloodstream infections,” Emerg Infect Dis, 7(2). 174-177. March-Apr. 2001.
[22]  Eggimann, P., Sax, H. and Pittet, D, “Catheter-related infections,” Microbes Infect, 6(11).1033-1042. Sep. 2004.
[23]  Pittet, D, “Infection control and quality health care in the new millennium,” Am J Infect Control, 33(5). 258-267. Jun 2005.
[24]  Mermel, L.A, “Prevention of intravascular catheter-related infections,” Ann Intern Med, 132(5). 391-402. March 2000.
[25]  Darouiche, R.O, “Device-associated infections: a macroproblem that starts with microadherence,” Clin Infect Dis, 33(9). 1567-1572. Nov.2001.
[26]  O’ Gara, J.P. and Hmphreys, H, “Staphylococcus epidermidis biofilms: Importance and implications,” J Med Microbiol, 2001, 50(7). 582-587. Jul. 2001.
[27]  Huebner, J. and Goldmann, D.A, “Coagulase-negative staphylococci: role as pathogens,” Annu Rev Med, 50. 223-236. 1999.
[28]  Maki, D.G. and Tambyah, P.A, “Engineering out the risk of infection with urinary catheters,” Emerg Infect Dis, 7(2). 1-6. March-Apr. 2001.
[29]  Pappas, P.G., Rex, J.H., Sobel, J.D., Filler, S.G., Dismukes, D.E., Walsh, T.J. and Edwards, J.E, “Guidelines for treatment of candidiasis,” Clin Infect Dis, 38(2). 161-189. Jan. 2004.
[30]  Crnich C.J. and Maki, D.G, “The promise of novel technology for the prevention of intravascular device-related bloodstream infection. I. Pathogenesis and short term devices,” Clin Infect Dis, 34(9) 1232-1242. May 2002.
[31]  El-Azizi, M., Starks, S. and Khardori, N, “Interactions of Candida albicans with other Candida species and bacteria in the biofilms,” J Apl Microbiol, 96(5). 1067-1073. 2004.
[32]  Busscher, H.J. and vand der Mei, H.C, “Use of flow chamber devices and image analysis methods to study microbial adhesion,” Methods Enzymol, 253. 455-477.1995
[33]  Lynch, R.J. and Ten Cate, J.M, “Effect of calcium glycerophosphate on demineralization in an in vitro biofilm model,” Caries Res, 40(2). 142-147. 2006.
[34]  Rosentritt, M., Hahnel, S., Groger, G., Muhlfriedel, B., Burgers, R. and Handel, G, “Adhesion of Streptococcus mutans to various dental materials in a laminar flow chamber system,” J Biomed Mater Res B Appl Biomater, 86(1). 36-44. Jul. 2008.
[35]  Xie, Q., Li, J. and Zhau, X, “Anticaries effect of compounds extracted from Galla chinensis in a multispecies biofilm model,” Oral Microbial Immunol, 23(6). 459-465. Dec. 2008.
[36]  Sjollema, J.H., Busscher, H.J. and Weer Kamp, A.H, “Deposition of oral Streptococci and polystyrene lattices onto glass in a parallel plate flow cell,” Biofouling, 1(2) 101-112. 1989
[37]  Christersson, C.E, Glantz, P.O. and Baier, R.E, “Role of temperature and shear forces on microbial detachment,” Scand. J Den Res, 96(2). 91-98. Apr. 1988.
[38]  Morisaki, H, “Measurement of the force necessary for removal of bacterial cells from aquartz plate,” Microbiol, 137. 2649-2655. 1991.
Show Less References


Antibodies to Echinococcus granulosus Egg Antigens in Hydatid Patients: Characterization by Immunoblot and Diagnostic Value

1Laboratory of Immunology, Institut Pasteur de Tunis, Tunis, TUNISIA

American Journal of Microbiological Research. 2015, 3(1), 33-40
DOI: 10.12691/ajmr-3-1-5
Copyright © 2015 Science and Education Publishing

Cite this paper:
Wissal IRAQI HOUSSAINI. Antibodies to Echinococcus granulosus Egg Antigens in Hydatid Patients: Characterization by Immunoblot and Diagnostic Value. American Journal of Microbiological Research. 2015; 3(1):33-40. doi: 10.12691/ajmr-3-1-5.

Correspondence to: Wissal  IRAQI HOUSSAINI, Laboratory of Immunology, Institut Pasteur de Tunis, Tunis, TUNISIA. Email:


Cystic echinococcosis/hydatidosis, caused by Echinococcus granulosus, is a chronic zoonotic larval cestode infection in humans. Human hydatidosis is a public health parasitic disease that is cosmopolitan in its distribution. Several years may last between contamination with E. granulosus eggs and development of symptomatic cysts. Antigens expressed by embryos at early differentiation steps between the embryo and the young cyst may be interesting as markers of early infection or reinfection. This study investigates antibody response (IgG) to E. granulosus egg antigens by Immunoblot (IB) and ELISA in 20 hydatid patients surgically confirmed. We have also tested sera using protoscoleces and hydatid cyst fluid (HCF) from E. granulosus. The results show that hydatid patients reacted to eggs as well as protoscoleces and HCF. However, eggs share antigens in common with other life-cycle stages, but also support the notion that they may possess some unique stage-specific antigens determinants. The possible functional significance and the potential use of combined assessment of these antigens in IB with Ig G response in ELISA are discussed.



[1]  World Heath Organisation. Echinococcosis. WHO Factsheet. 2013. N° 37.
[2]  Kilani M, Darghouth M, Lahmar S, Jaoua H and Jemli, M. Rôle du chien dans l’épidémiologie du kyste hydatique en Tunisie. La Tunisie Médicale, 1986; 64: 333-337.
[3]  Kilani M, Lahmar S, Jemli MH, Darghouth MA, Jomaa I, Diouani F, Ben Miled L, Iraqi W and Ben Ismail R. Prevalence of Echinococcus granulosus in captured dogs in Tunisia (parasitic necropsy). XVIII international congress of Hydatidology. 1997 ; Novembrer; Lisbonne-Portugal.
[4]  Anonymous. L’incidence chirurgicale de l’hydatidose en Tunisie (1988-1992). Rapport de la Direction des Soins et de Santé de Base, Tunis-Tunisie-Ministère de la santé publique. 1993.
[5]  Teggi A. An up-to-date on clinical management of human cystic echinococcosis. Parasitologia. 2004; Dec; 46 (4): 405-7.
Show More References
[6]  Wen H, New RRC, Craig PS. Diagnosis and treatement of human hydatidosis. British Journal of Clinical Pharmacology. 1993; 35: 565-574.
[7]  Lahmar S, Rebaï W, Boufana BS, Craig PS, Ksantini R, Daghfous A, Chebbi F, Fteriche F, Bedioui H, Jouini M, Dhibi M, Makni A, Ayadi MS, Ammous A, Kacem MJ, Ben Safta Z. Cystic echinococcosis in Tunisia: Analysis of hydatid cysts that have been surgically removed from patients. Annals of Tropical Medecine and Parasitology. 2009 October, 103 (7): 593-604.
[8]  M'rad S, Oudni-M'rad M, Boubaker G, Bouazzi L, Gorcii M, Nouri A, Mezhoud H, Babba H. Retrospective study of the distribution and the fertility of hydatid cysts in the child in Tunisia. Pathologie Biologie (Paris). 2012; Jun; 60 (3): 166-9.
[9]  Lahmar S, Trifi M, Ben NaceurS, Bouchhima T, Lahouar N, Lamouchi I, Maâmouri N, Selmi R, Dhibi M, Torgerson PR. Cystic echinococcosis in slaughtered domestic ruminants from Tunisia. Journal of Helminthology. 2013; September, 87(3): 318-25.
[10]  Lahmar S, Boufana BS, Inoubli S, Guadraoui M, Dhibi. M, Bradshaw H, Craig PS. Echinococcus in the wild carnivores and stray dogs of northern Tunisia: the results of a pilot survey. Annals of Tropical Medecine and Parasitology. 2009; 103 (4): 323-31.
[11]  M'rad S, Oudni-M’rad M, Filisetti D, Mekki M, Nouri A, Sayadi T, Candolfi E, Azaiez R, Mezhoud H, Babba H. Molecular identification of Echinococcus granulosus in Tunisia: First record of the Buffalo Strain (G3) in Human and Bovine in the Country. The Open Veterinary Science Journal. 2010; 4: 27-30.
[12]  Piantelli M, Pozzuoli R, Aru E, Musiani P. Echinococcus granulosus: Identification of subunits of the major antigens. Journal of Immunology. 1977; 119: 1382-1386.
[13]  Rickard MD, Lightowlers MW. Immunodiagnosis of hydatid disease. In : The biology of Echinococcus granulosus and hydatid disease (editor: R.C.A. Thompson). 1986. Georges Allen & Unwin, London: 217-249.
[14]  Lightowlers MW, Liu D, Haralambous A, Rickard MD. Subunit composition and specificity of the major cyst fluid antigen of Echinococcus granulosus. Molecular and Biochemical Parasitology. 1989; 37: 171-182.
[15]  Chamekh M, Facon B, Dissous C, Haque A, Capron A. Use of monoclonal antibody specific for a protein epitope of Echinococcus granulosus antigen 5 in a competitive antibody radioimmunoassay for diagnosis of hydatid disease. Journal of Immunological Methods. 1990; 134: 129-137.
[16]  Varela-Diaz VM, Guisantes JA, Ricardes MI, Yarzabal LA, Coltorti EA. Evaluation of whole and purified hydatid fluid antigens in the diagnosis of human hydatidosis by the immuno-electrophoresis test. American Journal of Tropical Medicine and Hygiene. 1975; 24: 298-303.
[17]  Yarzabal LA, Dupa H, Bout DT, Naquira FR, Capron AR. Echinococcus granulosus: The distribution of hydatid fluid antigens in the tissue of the larval stage. II: Localisation of the thermostable lipoprotein of parasitic origin (Antigen B). Experimental Parasitology. 1977; 42: 115-120.
[18]  Shephered JC, McManus DP. Specific and cross-reactive antigens of Echinococcus granulosus hydatid cyst fluid. Molecular and Biochemical Parasitology. 1987; 25: 143-154.
[19]  Maddison SE, Slemenda SB, Shantz PM, Fried JA, Wilson M, Tsang VCW. A specific diagnosis antigen of Echinococcus granulosus with an apparent molecular weight of 8 kDa. American Journal of Medecine and Hygiene. 1989; 40: 377-383.
[20]  Siracusano A, Ioppolo S, Notargiacomo S, Ortona E, Rigano R, Teggi A, De Rosa F, Vicari G. Detection of antibodies against Echinococcus granulosus major antigens and their subunits by immunoblotting. Transactions of the Royal Society of Tropical Medecine and Hygiene. 1991; 85: 239-243.
[21]  Leggatt GR, McManus DP. Identification and diagnostic value of a major antibody epitope on the 12 kDa antigen from Echinococcus granulosus (hydatid disease) cyst fluid. Parasite Immunology. 1992; 16: 87-96.
[22]  Riganò R, Profumo E, Bruschi F, Carulli G, Azzarà A, Ioppolo S, Buttari, B, Ortona E, Margutti P, Teggi, A, Siracusano, A. Modulation of human immune response by Echinococcus granulosus Antigen B and its possible role in evading host defenses. Infection and Immunity. 2001; Jan; 69(1): 288–296.
[23]  Craig PS, Rickard MD. Antibody responses of experimentally infected lambs to antigens collected during in vitro maintenance of the adult, metacestode or oncosphere stages of Taenia hydatigena and Taenia ovis with further observations on anti-oncospheral antibodies. Journal of Parasitology. 1982; 67: 197-209.
[24]  Craig PS, Rickard MD. Anti-oncospheral antibodies in serum of lambs experimentally infected with either Taenia ovis or Taenia hydatigena. Journal of Parasitology. 1981; 64: 169-177.
[25]  Craig PS, Macpherson CNL, Nelson GS. The identification of eggs of Echinococcus by Immunofluorescence using a specific anti-oncospheral monoclonal antibody. American Journal of Medicine and Hygiene. 1986; 35 (1): 152-158.
[26]  Rogan MT, Craig PS. Zehyle E, Masinde G, Wen H, Zhou P. In vitro killing of taeniid oncospheres mediated by human sera from hydatid endemic areas. Acta Tropica. 1992; 51: 291-296.
[27]  Heath DD, Lawrence SB. Antigenic polypeptides of Echinococcus granulosus oncospheres and definition of protective molecules. Parasite Immunology. 1996; 18: 347-357.
[28]  Lightowlers MW, Lawrence SB, Gauci CG, Young J, Ralston MJ, Maas D, Heath DD. Vaccination against hydatidosis using a defined recombinant antigen. Parasite Immunology. 1996; 18: 457-462.
[29]  Lowry OH, Rosbrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. The Journal of Biological Chemistry. 1951; 193: 265-275.
[30]  Laemmli UK. Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature. 1970; 227: 680-685.
[31]  Towbin H, Staehlin T, Gordan J. Electrophoretic transfer of protein from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proceedings of the National Academy of Sciences of the USA. 1979; 76: 4350-4354.
[32]  Yarzabal LA, Dupas H, Bout DT, Capron AR. Echinococcus granulosus: The distribution of hydatid fluid antigens in the tissue of the larval stage. I: Localisation of the specific antigen of hydatid fluid (antigen 5). Experimental Parasitology. 1976; 40: 391-396.
[33]  Moro PL, Bonifacio N, Gilman RH, Lopera L, Silva B, Takumoto R, Verastegui M, Cabrera L. Field diagnosis of Echinococcus granulosus infection among intermediate and definitive hosts in an endemic focus of human cystic echinococcosis. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1999; November-December; 93(6): 611-5.
[34]  Heath DD. The migration of oncospheres of Taenia pisiformis, Taenia serialis and Echinococcus granulosus within the intermediate host. International Journal for Parasitology. 1971; 1: 145-152.
[35]  Rausch RL. Studies on the helminth fauna of Alaska. The histogenesis of the alveolar larvae of Echinococcus species. Journal of Infectious Diseases. 1954; 94: 178-186.
[36]  Sakamoto T, Sugimura M. Electron microscopical observations on histogenesis of larval Echinococcus multilocularis. Japanese Journal of Veterinary Research. 1970, 18: 131-144.
[37]  Heath DD, Lawrence SB. Echinococcus granulosus: development in vitro from oncosphere to immature hydatid cyst. Parasitology. 1976; 73: 417-423.
[38]  Alvarez Rojas CA, Romig T, Lightowlers MW. Echinococcus granulosus sensu lato genotypes infecting humans--review of current knowledge. International Journal of Parasitology. 2014; January; 44(1):9-18.
[39]  Pini C, Pastore R, Valesnin G. Circulating immune complexes in sera of patients infected with Echinococcus granulosus. Clinical and Experimental Parasitology. 1983; 51: 572.
[40]  Richard-Lenoble D, Smith MD, Loisy M, Verroust PJ. Human hydatidosis: Evaluation of three serodiagnostic methods, the principal subclass of specific immunoglobulin and the detection of immune complexes. Annals of Tropical Medecine and Parasitology. 1978; 72: 553-560.
[41]  Marinova I, Nikolov G, Michova, Kurdova AR, Petrunov B. Quantitative assessment of serum-specific IgE in the diagnosis of human cystic echinococcosis. Parasite Immunology, 2011; 33 (7): 371-376.
[42]  Craig PS, Nelson GS. The detection of circulating antigen in human hydatid disease. Annals of tropical Medecine and Parasitology. 1984; 78 (3): 219-227.
[43]  Kanwar JR, Vinayak VK.. The significance of free and immune-complexed hydatid specific antigen(s) as an immunodiagnostic tool for human hydatidosis. Journal of Medical Microbiololgy. 1992; 396-403.
[44]  Craig PS. Detection of specific circulating antigen, immune complexes and antibodies in human hydatidosis from Turkana (Kenya) and Great Britain, by enzyme-immunoassay. Parasite Immunology. 1986; 8 (2): 171-188.
[45]  Gottstein B. An immunoassay for the detection of circulating antigens in human echinococcosis. American Journal of Medicine and Hygiene. 1984; 33: 1185-1191.
[46]  Purriel P, Shantz PM, Bevoide H, Mendoza G. Human echinococcosis in Uruguay: A comparison of indices of morbidity and mortality. Bulletin of the World Health Organisation. 1973; 49: 395-402.
[47]  Bonifacino R, Malgor R, Barbeito R, Balleste R, Rodriguez J, Botto C, klug F. Seroprevalence of Echinococcus granulosus infection in a Uruguayan rural human population. Transactions of the Royal Society of Tropical Medecine and Hygiene. 1991; 85: 769-772.
[48]  Maizels RM. Infections and allergy-helminths, hygiene and host immune regulation. Current Opinion in Immunology, 2005; 17 (6): 656-661.
[49]  Leggatt GR, Yang W, McManus DP. Serological evaluation of the 12 kDa subunit of antigen B in Echinococcus granulosus cyst fluid by immuno-blot analysis. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1992; 86: 189-192.
[50]  Profumo E, Ortona E, Rigano R, Gioia I, Notargiacomo S, Ippolo S, Siracusano A. Cellular and humoral responses to antigenic subunit of Echinococcus granulosus cyst fluid in hydatid patients. Parasite Immunology. 1994; 16: 393-398.
[51]  Delunardo F, Ortona E, Margutti P et al.. Identification of a novel 19 kDa Echinococcus granulosus antigen. Acta Tropica, 2010; 113 (1): 42-47, 2010.
[52]  Daeki AO, Craig PS, Shambesh MK. IgG-subclass antibody responses and the natural history of hepatic cystic echinococcosis in asymptomatic patients. Annals of Tropical Medicine and Parasitology, 2000; 94 (4): 319-328.
[53]  Moro PL, Garcia HH, Gonzales AE, Bonilla JJ, Verastegui M, Gilman RH. Screening for cystic echinococcosis in an endemic region of Peru using portable ultrasonography and the enzyme-linked immunoelectrotransfer blot (EITB) assay. Parasitology Research, 2005; 6 (4): 242-246.
[54]  Allen JE, Maizels RM. Diversity and dialogue in immunity to helminthes. Nature Reviews Immunology, 2011; 1: 375-388.
Show Less References


Evaluation of the Degree of Contamination of Salad Vegetables Sold in Umuahia Main Market

1Department of Microbiology, College of Natural Sciences, Michael Okpara University of Agriculture Umudike, Abia State, Nigeria.

American Journal of Microbiological Research. 2015, 3(1), 41-44
DOI: 10.12691/ajmr-3-1-6
Copyright © 2015 Science and Education Publishing

Cite this paper:
Nwankwo. I.U, Eze. V.C, Onwuakor. C.E, Friday. J.U. Evaluation of the Degree of Contamination of Salad Vegetables Sold in Umuahia Main Market. American Journal of Microbiological Research. 2015; 3(1):41-44. doi: 10.12691/ajmr-3-1-6.

Correspondence to: Onwuakor.  C.E, Department of Microbiology, College of Natural Sciences, Michael Okpara University of Agriculture Umudike, Abia State, Nigeria.. Email:


The evaluation of the degree of contamination of salad vegetables sold in Umuahia main market was carried out. Six Samples of salad vegetables (Cabbage, Carrot, Cucumber, Onions, Green peas and Green beans) sold around the market were analyzed. Total viable counts ranged from 2.35 x 105 to 9.50 x 105 cfu/ml with highest incidence seen in cabbage and onions sold by vendor A. 86.66% of cabbage samples were contaminated, with the least incidence seen in green bean (33.33%). Six bacterial and five fungal species were isolated. The isolates include: Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Bacillus sp, Enterobacter sp and Proteus sp. and the fungal isolates were Aspergillus sp. Yeast, Cladosporium sp. Penicillium sp. and Rhizopus sp. These results indicates that street vended salad vegetables where contaminated to an extent, and therefore, needs vigorous washing with safe running water before consuming to avoid food borne diseases associated with consumption of contaminated food.



[1]  Harli, V. and Franca, B. Fruits and Vegetables International Agency for Research on Cancers (IARC) Report 2, 2003.
[2]  Beuchat, L.R and Larry, R. Pathogenic Microorganism Associated with Fresh Produce. Journal of Food Protection 13:204-216. 2000.
[3]  Prigulkar, K.A., Kamat, O and Bougiruwar, D. Microbiology Quality of Fresh Leafy Vegetables, Salad Components and Ready to Eat Salads. Int. J. Food Science Nutrition 52: 15-23. 2000.
[4]  Beuchat, L.R Ecological Factor Influencing Survival and Growth of Human Pathogens on Raw Fruits and Vegetables Microb. Infection 4 (4): 413-423. 2002.
[5]  Liu, D. Identification, Sub typing and Virulence Determination of Listeria Monocytogenes, an Important Food Borne Pathogens. J. Med. Microbiol 55 (6): 645-659. 2006.
Show More References
[6]  Kalia, A. and Gupta, R.P. Fruit Microbiology. In: Hui Y.H.J., Cano, M.P., Gusek, W., Sidhu, J.W., Sinha, N.K. Handbook of Fruit and Fruit Processing. 1st Edt. Blackwell Publishing, 2006, 3-28.
[7]  Carmo, L.S., Cumnings, C., Lenardi, V.R., Dias, R.S., Souza, J.M., Sena, M.J., Santos, D.A., Shupp, J.W., Pereira, R.K., Jett, M. A Case Study of a Massive Staphylococcal Food Poisoning Incident Food Borne Pathog. Dis 1:241-246. 2004.
[8]  Ray, B. and Bhunia, A.K. Fundamental Food Microbiology 4th Edt. CRC Press. U.S.A. 2007, 4-13.
[9]  Ofor, M.O., Okorie, V.C., Ibeawuchi, U., Ihejirika, G.O., Obilo, O.P., and Dialoka, S.A. Microbial Contaminant in Fresh Tomato Wash Water and Food Safety Consideration in South-Eastern Nigeria. Life Science J. 1:80-82. 2009.
[10]  Vishwanathan, P. and Kaur, R. Prevention and Growth of Pathogens on Salad Vegetables, Fruits and Sprouts. Intl. J. Hyg. Environ. Health 203: 205-213. 2000.
[11]  Beuchat, L.R Pathogenic Microorganisms Associated with Fresh Produce Journal of Food Protection 59: 204-216. 1996.
[12]  Vanderzant, C. and Splittoeser, D.F. Compendium of Methods for the Microbiological Examination of Foods Washington D.C. American Health Association, 1992, 44-61.
[13]  Beuchat, L.R and Brackelt, R.E. Survival and Growth of Listeria monocytogens on Lettuce as Influenced by Shredding, Chlorine Treatment, Modified, Packaging and Temperature Journal of Food Protection 55 (3): 755-758. 1998.
[14]  Leus, J., Venter, P. Westhuizen, J., and Vander, H., Enumeration of Potential Microbiology Hazards in Milk from a Marginal Urban Settlement in Central South Africa. Food Microbiology 321-326. 2002.
[15]  Bean, N.H. and Griffin, P.M. Food Borne Disease Outbreaks in the United States 1973-1987: Pathogens, Vehicles and Trends Journal of Food Protection 53: 807-814. 1992.
Show Less References


Development of SCAR marker for Specific Detection of Trichoderma harzanium and Trichoderma viride

1Department of Biotechnology, College of Agriculture, Junagadh Agriculture University, Junagadh -362001, India

2Scientific Research Center, Biotechnology and Genetic Engineering Unit, Taif University, KSA

3Genetics Department, Faculty of Agriculture, Minufiya University, Egypt

4Microbiology Dept, MVM Science and Home Science College, Saurashtra University, Rajkot -360001, India

American Journal of Microbiological Research. 2015, 3(1), 45-49
DOI: 10.12691/ajmr-3-1-7
Copyright © 2015 Science and Education Publishing

Cite this paper:
H. J. Parmar, M. M. Hassan, N. P. Bodar, H .N. Lakhani, V. V. Umrania, B. A. Golakiya. Development of SCAR marker for Specific Detection of Trichoderma harzanium and Trichoderma viride. American Journal of Microbiological Research. 2015; 3(1):45-49. doi: 10.12691/ajmr-3-1-7.

Correspondence to: M.  M. Hassan, Scientific Research Center, Biotechnology and Genetic Engineering Unit, Taif University, KSA. Email:


Trichoderma have been used as biological control agents against soil borne plant pathological fungi such as S. rolfsii. On this day molecular based techniques has been developed to detect T. harzanium using a fungus-specific marker derived from genomic DNA. An amplified RAPD product of 220 bp and 900 bp obtained in T. harzanium (NBAII Th 1) and T. viride (NBAII Tv 2) isolates, respectively. These two RAPD products were obtained using two random primers OPA-16 for harzanium (NBAII Th 1) isolate and OPC-05 for T. viride (NBAII Tv 2), thin RAPD products were sequenced. Based on sequences, one primers were designed, out of which a primer pair HAR220FP5 (CTTTTGGTTTGACACGGTTCT and HAR220RP5 (AAGCTTTGAAGTTGCGAGGA) amplified a sequence of 220 bp. and VIRI900FP7 (TACGCTCCAGGCTACCACTT) VIRI900RP7 (GAGATGAGCTCCTTGCTGCT) amplified a sequence of 900 bp. which was specific to T. harzianum and T. viride, respectively. The specificity of the marker when tested against six isolates of Trichoderma species showed a specific band of 220 bp. only in T. harzanium and a specific band of 900 bp. only in T.viride with the optimized PCR parameters. This sequence characterized amplified region (SCAR) marker was sensitive and could detect small quantities of Trichoderma DNA as low as 25 to 30 ng with high efficiency. This marker could also clearly distinguish T. harzianum and T. viride from other isolates of Trichoderma.



[1]  Knudsen IMB, Jensen B, Jensen DF, Hockenhull J (1996) Occurrence of Gliocladium roseum on barley roots in sand and field soil. Kluwer Academic Publishers, Netherlands.
[2]  Seaby DA (1996) Differentiation of Trichoderma taxa associated with mushroom production. Plant Pathol 45: 905-912.
[3]  Shahid M, Singh A, Srivastava M, Srivastava DK (2014) Molecular Characterization of Trichoderma viride isolated from rhizospheric soils of uttar pradesh based on rDNA markers and analysis of their PCR-ISSR profiles. J Mol Biomark Diagn 5: 169.
[4]  Ospina-Giraldo MD, Royse DJ, Chen X, Romaine CP (1999) Molecular Phylogenetic Analyses of Biological Control Strains of Trichoderma harzianum and Other Biotypes of Trichoderma spp. Associated with Mushroom Green Mold. Phytopathology 89: 308-313.
[5]  Hassan M M (2014). Influence of protoplast fusion between Trichoderma spp. enhances extracellular enzymes and antagonistic activity against some soil pathogens. Biotechnology and biotechnological equipments, 28: 1014-1023.
Show More References
[6]  Hassan M M, A Gaber and E I. El-Hallous (2014) Molecular and Morphological Characterization of Trichoderma harzianum from different Egyptian Soils, Wulfenia Journal, 21: 80-96.
[7]  Hermosa, M. R., Grondona, I., Iturriaga, E. A., Dia-MinGuez, Castro, C., Monte, E. and Garcia-Acha, I. 2000. Molecular characterization and identification of biocontrol isolates of Trichoderma spp. Applied and Env. Microbiology. 66 (5): 1890-1898.
[8]  Venkateswarulu, R., Reddi Kumar, M., Eswara Reddy, N. P. and Sudhakar, P. 2008. Molecular characterization of Trichoderma spp. used against Fusarium wilt with PCR based RAPD and ITS-PCR. J. Mycology and Plant Pathology. 38 (3): 559-563.
[9]  Abbasi P. A., Miller S. A., Mealia T., Hoitink H. A. J., and Kim J. M. (1999). Precise detection and tracing of Trichoderma hamatum 382 in compost amended potting mixes by using molecular markers. Appl. Environ. Microbiol. 12: 5421-5426.
[10]  Lecomte P, Peros JP, Blancard D, Bastien N, Delye C (2000). PCR assays that identify the grapevine dieback fungus Eutypa lata. Appl. Environ. Microbiol. 66: 4475-4480.
[11]  Li KN, Rouse DI, Eyestone EJ, German TL (1999). The generation of specific DNA primers using random amplified polymorphic DNA and its application to Verticillium dahliae. Mycol. Res. 103: 1361-1368.
[12]  Schilling AG, Moller EM, Geiger HH (1996). Polymerase chainreactionbased assays for species-specific detection of Fusarium culmorum, F. graminearum, and F. avenaceum. Phytopathol. 86: 515-522.
[13]  Watanabe N (1984) Bulletin of Faculty of Agriculture, Maiji University, Japan 66: 45.
[14]  Doyle J. J, Doyle J. L (1987) .A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull .19: 11-15.
[15]  Shalini 1, Narayan, K. P. 1, Lata1 and Kotasthane, A. S. (2006). Genetic relatedness among Trichoderma species inhibiting a pathogenic fungi Rhizoctonia solani. African Journal of Biotechnology Vol. 5 (8), pp. 580-584.
[16]  Sneath, P. H. A. and Sokal, R. R. (1973). Numerical Taxonomy: The Principles and Pratice of Numerical Classification. San Francisco: Freeman, 573 pp.
[17]  Lieckfeldt, G.J. Samuels, H.I. Nirenberg, O. Petrini A. (1999). morphological and molecular perspective of Trichoderma viride: is it one or two species Appl. Environ. Microbiol. 65: 2418-2428.
[18]  Kandoliya U.K. and D. N. Vakharia (2013) Antagonistic effect of Pseudomonas fluorescens against fusrium oxysporum f.sp. Ciceri causing wilt in chickpea. Legume Research., 36 (6) 569-575.
[19]  Zimand, G., Valinsky, L., Elad, Y., Chet, I., Manualis, S. (1994). Use of RAPD procedure for the identification of Trichoderma species. Mycol. Res. 98, 531-534.
[20]  Bulat, S. A., Lubeck, M., Mironenko, N. V., Jensen, D. F., Lubeck, P. S. (1998). UPPCR analysis and ITS1 ribotyping of Trichoderma and Gliocladium fungi. Mycol. 102: 933-943.
[21]  Cumagun CJR, Hockenhull J, Lübeck M (2000) Characterization of Trichoderma isolates from Philippine rice fields by UP-PCR and rDNA-ITSI analysis: identification of UP-PCR markers. Journal of Phytopathology 148: 109-115.
[22]  Naeimi, S. (2010). Development of a specific molecular marker for detection of the most effective Trichoderma strain against Than at ephoruscucumeris, the causal agent of rice sheath blight disease. Ph.D thesis, Faculty of Agriculture, University of Tehran, Karaj, Iran.
Show Less References


Molecular Identification 0f 16s Ribosomal RNA Gene of Helicobacter pylori Isolated from Gastric Biopsies in Sudan

1Department of Microbiology, Kassala University, Sudan

2Department of Microbiology, Khartoum University, Sudan

3Virology Department Central lab, Sudan

4Consultant Physician and Gastroenterology, Sudan

5Department of Bioinformatics, Africa City of Technology, Sudan

6Division of Molecular Genetics, Institute of Human Genetics, University of Tübingen, Germany

American Journal of Microbiological Research. 2015, 3(2), 50-54
DOI: 10.12691/ajmr-3-2-1
Copyright © 2015 Science and Education Publishing

Cite this paper:
Mona Mamoun, Elsanousi S. M., Khalid A. Enan, Abdelmounem E. Abdo, Mohamed A. Hassan. Molecular Identification 0f 16s Ribosomal RNA Gene of Helicobacter pylori Isolated from Gastric Biopsies in Sudan. American Journal of Microbiological Research. 2015; 3(2):50-54. doi: 10.12691/ajmr-3-2-1.

Correspondence to: Mona  Mamoun, Department of Microbiology, Kassala University, Sudan. Email:


H. pylori are a ubiquitous microorganism infecting up to half of the world’s population. A total of 81 gastric biopsies taken from patients complaining of gastric disorders in Khartoum state, Sudan screened for H.pylori. Eighteen samples (22.2%) yielded positive culture results. The majority of them were males. Also results indicated higher prevalence of H. pylori in patients with gastritis. Further identification performed using PCR targeted a region of 16S ribosomal RNA gene of H. pylori and gene amplified on 12 samples. Six of isolated sequences subjected to BLAST analysis that showed high similarity to GenBank strains of H. pylori.Multiple sequence alignments were performed between isolated 16S rRNA gene sequences and most related H.pylori strains deposited on GenBank. One isolate differed on one base-pair substitution (G-A) from other isolates and selected reference H.pylori strains. Phylogenetic analysis based on 16S rRNA gene sequences reflects that H.pylori could be originated from Africa.



[1]  Warren JR, Marshall BJ. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet; 1:1273-1275. 1983.
[2]  Brown L. M. Helicobacter pylori: epidemiology and routes of transmission. Epidemiol. Rev.22:283-97. 2000.
[3]  Lacy BE, Rosemore J. Helicobacter pylori: ulcers and more: the beginning of an era. J Nutr.131:2789S-93S. 2001.
[4]  Everhart J. E. Recent developments in the epidemiology of Helicobacter pylori. Gastroenterol Clin North Am.29: 559-579. 2000.
[5]  Woodward M, Morrison C, McColl K. An investigation into factors associated with Helicobacter pylori infection. J Clin Epidemiol.53:175-181. 2000.
Show More References
[6]  Makola D, Peura D, Crowe S. Helicobacter pylori infection and related gastrointestinal diseases. J Clin Gastroenterol.41:548–-8. 2007.
[7]  Dunn BE, Cohen H, Blaser MJ. Helicobacter pylori. Clinical Microbiology Reviews; 10: 720-741. 1997.
[8]  Midolo P, Marshall BJ. Accurate diagnosis of Helicobacter pylori: Urease tests. Gastroenterol Clin North Am; 29:871-878. 2000.
[9]  Falush D, Wirth T, Linz B, Pritchard JK, Stephens M, et al. Traces of human migrations in Helicobacter pylori populations. Science; 299:1582-1585. 2003.
[10]  Garner JA, TL C: Analysis of genetic diversity in cytotoxin-producing and non-cytotoxin-producing Helicobacter pylori strains. J Infect Dis. 172:290-293. 1995.
[11]  Achtman M, Azuma T, Berg DE, Ito Y, Morelli G, et al. Recombination and clonal groupings within Helicobacter pylori from different geographical regions. Mol Microbiol. 32: 459-470. 1999.
[12]  Covacci A, Telford JL, Del Giudice G, Parsonnet J, Rappuoli R. Helicobacter pylori virulence and genetic geography. Science; 284: 1328-1333. 1999.
[13]  Suerbaum S, Maynard Smith J, Bapumia K, Morelli G, Smith NH, et al. Free recombination within Helicobacter pylori. Proc Natl Acad Sci U S A. 95:12619-12624. 1998.
[14]  Taylor JM, Ziman ME, Huff JL, Moroski NM, Vajdy M, Solnick JV. Helicobacter pylori lipopolysaccharide promotes a Th1 type immune response in immunized mice. Vaccine; 24(23):4987-94. 2006.
[15]  Hoshina S, Kahn SM, Jiang W, Green PH, Neu HC, Chin N. Direct detection and amplification of Helicobacter pylori ribosomal 16S gene segments from gastric endoscopic biopsies. Diagn Microbial Infect Dis.13:473-9. 1990.
[16]  Yoshida H, Hirota K, Shiratori Y, Nihei T, Amano S, Yoshida A. Use of a gastric juice-based PCR assay to detect Helicobacterpylori infection in culture-negative patients. J Clin Microbiol; 36:317-20. 1998.
[17]  Chong SK, Lou Q, Fitzgerald JF, Lee CH. Evaluation of 16SR RNA gene PCR with primers Hp1 and Hp2 for detection of Helicobacter pylori J Clin Microbiol; 34:2728-30. 1996.
[18]  Smith SI, Oyedeji KS, Arigbabu AO, Cantet F, Megraud F, et al. (2004).Comparison of three PCR methods for detection of Helicobacter pylori DNA and detection of cagA gene in gastric biopsy specimens. World J Gastroenterol. 10:1958-1960.
[19]  Gorkiewicz G, Feierl G, Schober C, Dieber F, Kofer J, et al. Species- specific identification of Campylobacters by partial 16S rRNA gene sequencing. J Clin Microbiol. 41: 2537-2546. 2003.
[20]  Khan MM, Stoker NG, Drasar BS. Sequence diversity of a fragment of the 16S RNAgene from Helicobacter pylori. Microbios 103, 2000.
[21]  Atschul SF, Madden TL, Schaffer AA et al. Gapped BLAST and PSI-BLAST. A new generation of protein database search programmes”. NucleicAcid Res. 25: 3389-3402. 1997.
[22]  Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT”. Nucl. Acids. Symp. Ser. 41: 95-98. 1999.
[23]  McWilliam H, Li W, Uludag M. Analysis Tool Web Services from the EMBL-EBI” Nucleic acids research: 2013.
[24]  Chevenet F., Brun C., Banuls AL., Jacq B., Chisten R. TreeDyn: towards dynamic graphics and annotations for analyses of trees. BMC Bioinformatics; 10; 7:439. Oct, 2006.
[25]  Dereeper A., Guignon V., Blanc G., Audic S., Buffet S., Chevenet F., Dufayard J.F., Guindon S., Lefort V., Lescot M., Claverie J.M., Gascuel O. robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008
[26]  Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32(5):1792-7. Mar, 2004.
[27]  Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 17(4):540-52. Apr, 2000.
[28]  Guindon S., Gascuel O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol. 52(5):696-704. Oct, 2003.
[29]  Anisimova M., Gascuel O. Approximate likelihood ratio test for branchs: A fast, accurate and powerful alternative. Syst Biol. 55(4):539-52. Aug, 2006.
[30]  Woodward M, Morrison C, McColl K: An investigation into factors associated with Helicobacter pylori infection.
[31]  Zhiyu Zhang, Qing Zheng, Xiaoyu Chen, Shudong Xiao, Wenzhong Liu and Hong Lu, The Helicobacter pylori duodenal ulcer promoting gene, dupA in China, BMC Gastroenterology, 8:49.2008.
[32]  Stella I. Smith, Muinah A. Fowora, Jesse A. Otegbayo, Fatimah B. Abdulkareem, Emmanuel A.Omonigbehin, Akere Adegboyega, Monica Contreras, Rainer HaasComparison of PCR with other diagnostic techniques for the detection of H. pylori infection in patients presenting with gastroduodenal symptons in Nigeria. Int J Mol Epidemiol Genet. 2(2):178-184. 2011.
[33]  Marais A, Monteiro L, Occhialini M, Pina M,Lamoliatte H and Megraud F. Direct detectionof Helicobacter pylori resistance to macrolides by a polymerase chain reaction/DNA enzyme immunoassay in gastric biopsy specimens. Gut. 44: 463-467. 1999.
[34]  Peek RM, Miller GG, Tham KT, Perez-Perez GI, Cover TL, Atherton JC, et al. Detection of Helicobacter pylori gene expression in human gastric mucosa. J Clin Microbiol. 33(1):28-32.1995.
[35]  A. A. Vanzwet, J. C. Thijs, A. M. D. Kooistra-Smid, J. Schirm AND J. A. M. Snijder. Sensitivity of Culture Compared with That of Polymerase Chain Reaction for Detection of Helicobacterpylori from Antral Biopsy Samples. American Society for Microbiology, 1993.
[36]  Ousman Secka, Martin Antonio, Mary Tapgun, Douglas E Berg, Christian Bottomley, Vivat Thomas,Robert Walton, Tumani Corrah, Richard A Adegbola and Julian E Thomas. PCR-based genotyping of Helicobacter pylori ofGambian children and adults directly from biopsy specimens and bacterial cultures. Gut Pathogens, 3:5.2011.
[37]  Mohamed Siddig Abdalaziz, Munsoor Mohammed Munsoor, Wifaq Al fatih Siyam. Association between Helicobacter pylori Infection and Stomach Tumors in Sudan Using Polymerase Chain Reaction. Australian Journal of Basic and Applied Sciences, 7(4): 769-773, 2013.
[38]  Xu GM, Ji XH, Li ZS, Man XH, Zhang HF. Clinical significance of PCR in Helicobacter pylori DNA detection in human gastric disorders. China Nati J New Gastroenterol. 3(2):98-100. 1997.
[39]  Bruce, W., Eckloff, Podzorski, P., Kline, C., and Cockerill, R., Int. J. Sys. Bacteriol.44 (2) 320. 1994.
[40]  Vandamme P, Harrington CS, Jalava K, On SL. Misidentifying helicobacters: the Helicobacter cinaedi example. J Clin Microbiol.38: 2261-2266. 2000.
[41]  Stackebrandt, E. & Liesack, W. The potential of rDNA in identification autodiagnostics, in “Nonradioactive labelling and detection of biomolecules”(C. Kessler). Springer-Verlag, Berlin. 232-239 1992.
[42]  Dauga, C., Gillis, M., Vandamme, P., Ageron, E., Grimont, F., Kersters, K., de Mahenge, C., Peloux, Y. & Grimont, P.A.D. Balneatrix alpica gen. nov., sp. nov., a bacterium associated with pneumonia and meningitidis in a spa therapy center. Rex Microbial.144, 35-46. 1993.
[43]  Guo-Chao Wei, Jing Chen, Ai-Yun Liu, Miao Zhang, Xiao-Jun Liu, Dan Liu, Jun Xu, Bing-Rong Liu, Hong Ling, Hua-Xing Wu, Ya-Ju Du. Prevalence of Helicobacter pylori vacA, cagA and iceA genotypes and correlation with clinical outcome, 2012.
[44]  Y Yamaokaa, M Kitab, T Kodamaa, N Sawaia, K Kashimaa, J Imanishib. Induction of various cytokines and development of severe mucosal inflammation by cagA gene positive Helicobacter pylori strains, Kyoto Prefectural University of Medicine, Kyoto, Japan 1997.
[45]  Taylor DE, Eaton M, Chang N and Salama SM. Construction of a Helicobacter pylori genome map and demonstration of diversity at the genome level. J. Bacteriol. 174, 6800-6806. 1992.
[46]  Yoshan Moodley, Bodo Linz, Robert P. Bond, Martin Nieuwoudt,Himla Soodyall, Carina M. Schlebusch,5Steffi Bernhöft, James Hale, Sebastian Suerbaum, Lawrence Mugisha, Schalk W. van der Merwe, and Mark Achtman. Age of the Association between Helicobacter pylori and Man PLoS Pathog. 8 (5): e1002693. May 2012.
Show Less References


Isolation and Molecular Characterization of Cellulolytic Bacillus Isolates from Soil and Compost

1Department of Botany and Agric. Biotechnology, Faculty of Agriculture, University of Khartoum, 13314 Shambat, Sudan

2Department of Botany, Faculty of Science, University of Khartoum, Sudan

American Journal of Microbiological Research. 2015, 3(2), 55-58
DOI: 10.12691/ajmr-3-2-2
Copyright © 2015 Science and Education Publishing

Cite this paper:
Elhadi A. I. Elkhalil, Fatima Y. Gaffar, Marmar A. El Siddig, Huda A. H. Osman. Isolation and Molecular Characterization of Cellulolytic Bacillus Isolates from Soil and Compost. American Journal of Microbiological Research. 2015; 3(2):55-58. doi: 10.12691/ajmr-3-2-2.

Correspondence to: Elhadi  A. I. Elkhalil, Department of Botany and Agric. Biotechnology, Faculty of Agriculture, University of Khartoum, 13314 Shambat, Sudan. Email:


Fifty five Bacillus isolates were isolated from compost, and alkaline silty clay soil (rhizosphere of potato plant) in Shambat, Khartoum North, Sudan, and screened using morphological tests, biochemical and molecular characterization using 16s rDNA analysis., Screening of cellulase producing isolates was done using carboxyl methyl cellulose (CMC) as a substrate at 25°C. Twenty six isolates were found to be cellulase producers. Among the isolates, four isolates, 9+, 23, 20 and 13 showed high potential in producing extracellular cellulase and had an average cellulase activity of 2.89, 3.12, 3.48 and 3.53 Unit/ml, respectively. Genetic distance between the four isolates with high cellulase activity was determined with RAPD analysis based on OPC-3 primer.



[1]  Dio R.H. (2008). Cellulases of mesophilic microorganisms: Cellulosome and no cellulosome producers. Ann NY A cad Sci. (1125): 167-279.
[2]  Rastogi G.; MappidiG.l.; Gurram R.N.; Adhikari A. Bischoff K. M.; Hughes S.R.; Apel W.A.; Bangss Dixon D.J. and Sani, R.K. (2009). Isolation and characterization of cellulose degrading bacteria from the deep subsurface of the Homestako gold mine, lead, southe Dakota, VSA. J Ind Microbiol Biotechol 36 (4): 585-598.
[3]  Meddeb-Mouelhi, F.; Moisan, J.K. and Beauregard, M. (2014). A comparison of plate assay methods for detecting extracellular cellulase and xylanase activity. Enzyme and Microbial Technology, 66: 16-19.
[4]  Percival Zhang, Y. H.; Himmel, M. E. and Mielenz, J. R. (2006). Outlook for cellulase improvement: Screening and selection strategies. Biotechnology Advances, 24: 452-481.
[5]  Kasana R.C.; DharH.; Dutt S. andGulati A. (2008) Arapid and easy method for the detection of microbial cellulases on agar plates using grams iodine. CurrMicrobiol 57 (5): 503-507.
Show More References
[6]  Kim; Woon T.; Kim Y.; Kim S.; Lee J.; Dark C. and Kim H. (2010) Identification and Distribution of Bacillus species in Doenjang by Whole-cell Protein Patterns and 16s r RNA Gene sequence Analysis. J. Microbiol. Biotechnol, 20 (8): 1210-1214.
[7]  Qingming Y.; Zongping X. and Tiansheng T. (1997). Rapid Classification of Bacillus Isolate Using RAPD Technique. Wuhan University. Journal of Natural Sciences 2: 1, 105-109.
[8]  Woese C.R.; E. Stackebbrandt; T. J. Macke and G. E. fox (1985) Aphylogenetic definition of the major eubacterial taxa syst. Appl. Microbiol. 6: 143-151.
[9]  Barney M.; Volgyi A.; Novarro A. and Ruder D. (2001) Riboprinting and 16s r RNA Gene sequencing for Identification of Brewery Pediococcus Isolate. Appl Environ Microbiol 67 (2): 553-560.
[10]  Lindquist J. (2006) Bacillus isolation. Bact. 102 Website-Fall.
[11]  Harrigan W.F. and McCance M.E (1976) Laboratory Methods in Microbiology, Academic press, London and New York.
[12]  Kasing A. (1995). Cellulase production, Practical biotechnology, Practical Biotechnology, Sarawak, Malaysia.
[13]  Kotchoni S.O. and Shonukan O.O. (2002) Regulatory mutations affecting the synthesis of cellulase in Bacillus pumilus. World journal of Microbiology and Biotechnology 18: 487-491.
[14]  Miller G.L. (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical Chemistry, 31 (3): 426-428.
[15]  Soumet C.; Ermel, G.; Fach, P. and Colin, P. (1994).Evaluation of different DNA extraction procedures for the detection of Salmonella from chicken products by polymerase chain reaction. Lett. Appl. Microbiol., 19, 294-298.
[16]  Saitou, N. and Nei, M. (1987). The neighbor-joining method: A new method for reconstructing polyogenetic trees. Molecular Biology Evolution. 4 (4): 406-425.
[17]  SneathP.H. and Mair N.S. (1986). Bergy’s Manual of systemic bacteriology, ninth edition. Vol. 2, Wiliams and Wilkins Baltimore, U.S.A.
[18]  Drancourt M.; Bollet C.; Calioz A.; Martelin R.; Gayral J. and Raoutt D. (2000). 16s Ribosomal DNA sequence Analysis of a large collection of Environmental and clinical Un identifiable Bacterial isolates. J clin Microbiol 38 (10): 3623-3630.
Show Less References


Detection of Extended Spectrum Beta Lactamase (ESBL) Producing Klebsiella pneumoniae Associated with Tuberculosis Suspected Patients in Basra Governorate, South of Iraq

1College of Nursing / University of Basra

American Journal of Microbiological Research. 2015, 3(2), 59-61
DOI: 10.12691/ajmr-3-2-3
Copyright © 2015 Science and Education Publishing

Cite this paper:
Abdulameer Abdullah Al-Mussawi. Detection of Extended Spectrum Beta Lactamase (ESBL) Producing Klebsiella pneumoniae Associated with Tuberculosis Suspected Patients in Basra Governorate, South of Iraq. American Journal of Microbiological Research. 2015; 3(2):59-61. doi: 10.12691/ajmr-3-2-3.

Correspondence to: Abdulameer  Abdullah Al-Mussawi, College of Nursing / University of Basra. Email:


Objective: To investigate extended spectrum β- lactamase (ESBL) producing Klebsiella pneumoniae isolated from sputum of tuberculosis suspected patients in Basra governorate. Methods: A total of 28 (30.4 %) isolates of K. pneumoniae were recovered from 92 sputum clinical specimens at Pulmonary and Respiratory Diseases Center (PRDC) in Basra Governorate, Iraq. All these isolates were tested for ESBL production by using chromogenic media. Results: Of 28 isolates of K. pneumoniae, 6 (21.4%) were positive for ESBL production. Conclusion: This finding demonstrates a high percentage of ESBL producers among clinical isolates of K. pneumoniae. Presence of ESBL producing K. pneumoniae associated with TB patient gives a high risk factor to patients.



[1]  Sarathbabu R, Ramani TV, Bhaskara rao K, Panda S. Antibiotic susceptibility pattern of Klebsiella pneumoniae isolated from sputum, urine and pus samples. J Pharm and Biolo Sci. 2012; 1( 2): 4-9.
[2]  Nordmann P, Cuzon G, Naas T. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis. 2009; 9: 228-236.
[3]  Walsh C. Antibiotics: actions, origins, resistance. Washington DC.2003; ASM Press.
[4]  Ghuysen J M. Serine beta-lactamases and penicillin-binding proteins. Ann Rev Microbiol. 1991; 45:37-67.
[5]  Paterson D L, Bonomo R A. Extended-spectrum beta-lactamases: a clinical update. Clinical Microbiology Reviews. 2005; 18: 657-686. [PubMed: 16223952].
Show More References
[6]  Morosini M I, Canton R, Martinez-Beltran J, Negri M C, Perez- Dia J C, Baquero F, Blazquez J. New extended-spectrum TEM-type b-lactamase from Salmonella enterica subsp enterica isolated in a nosocomial outbreak. Antimicrob. Agents Chemother. 1995; 39: 458-461.
[7]  Philippon A, Ben-Redjeb S, Fournier G, Ben-Hassen A. Epidemiology of extended spectrum b-lactamases. Infec.1989; 17: 347-354.
[8]  Cormican M G, Marshall S A, Jones R N. Detection of Extended-Spectrum b-Lactamase (ESBL)- Producing Strains by the Etest ESBL Screen. J Clin Microbiol. 1996; 34(8): 1880-1884.
[9]  Tavakoli H, Bayat M, Kousha A, Panahi P. The Application of Chromogenic Culture Media for Rapid Detection of Food and Water Borne Pathogen. Am-Euras. J. Agric. & Environ. Sci. 2008; 4 (6): 693-698.
[10]  Kumar MS, Lakshmi V, Rajagopalan R. Occurrence of extended spectrum b−lactamases among enterobacteriaceae spp. isolated at a tertiary care institute. Indian J Med Microbiol. 2006; 24:208-211.
[11]  Ndugulile F, Jureen R, Harthug S, Urassa W, Langeland N. Extended spectrum b-lactamases among gram negative bacteria of nosocomial origin from an intensive care unit of a tertiary health facility in Tanzania. BMC Infect Dis. 2005; 5:86.
[12]  Ahmed A, Zafar A, Mirza S. Antimicrobial activity of tigecycline against nosocomial pathogens in Pakistan: a multicenter study. J Pak Med Assoc. 2009; 59:240-2.
[13]  James AL, Perry JD, Rigby A. Stanforth SP. Synthesis and evaluation of novel chromogenic aminopeptidase substrates for microorganism detection and identification. Bioorganic and Medicinal Chemistry Letters. 2007; 17(5): 1418-1421.
[14]  Manafi M, Restaino P, Schubert L. Isolation and detection of L. monocytogenes using protect media. J Appl Bacteriol. 2005; 62: 244-51.
[15]  Pfaller M A, Segreti J. Overview of the epidemiological profile and laboratory detection of extended-spectrum b-lactamases. Clin Infect Dis. 2006; 42:153-S163.
[16]  Roshan M, Ikram A, Mirza I A, Malik N, Abbasi A, Alizai S A. Susceptibility Pattern of Extended Spectrum ß- actamase Producing Isolates in Various Clinical Specimens. J of the Coll of Physici and Surge Pak. 2011; 21 (6): 342-346.
Show Less References


Isolation and Molecular Identification of New Emergent Candida Lusitaniae Isolated from Sudanese Immunocompromised Patients Infected with Oropharyngeal Candidiasis

1Department of Clinical Laboratory, College of Applied medical sciences, Al Jouf University, Sakaka, Saudi Arabia

2Department of Microbiology, College of Medical laboratory, Sudan University of science and technology, Khartoum, Sudan

American Journal of Microbiological Research. 2015, 3(2), 62-64
DOI: 10.12691/ajmr-3-2-4
Copyright © 2015 Science and Education Publishing

Cite this paper:
Mutaz F. Saad, Amr M. Albasha. Isolation and Molecular Identification of New Emergent Candida Lusitaniae Isolated from Sudanese Immunocompromised Patients Infected with Oropharyngeal Candidiasis. American Journal of Microbiological Research. 2015; 3(2):62-64. doi: 10.12691/ajmr-3-2-4.

Correspondence to: Mutaz  F. Saad, Department of Clinical Laboratory, College of Applied medical sciences, Al Jouf University, Sakaka, Saudi Arabia. Email:


Seventy seven oral swab samples (n=77) were collected in period between august 2007 to may 2008 from hospitalized immunocompromised and HIV patients suspected for Oropharyngeal Candidiasis and admitted in different hospitals in Ed-wiuem state and Khartoum state, Sudan. All samples were inoculated on Sabouraud dextrose agar and identified by colonial morphology, Germ tube test and Vitek2 compact system for biochemical identification and antifungal susceptibility test. Out of 77 oral swab samples collected from immunocompromised and HIV patients, 41 (53.3%) samples showed positive growth of Candida, and 36 (46.7%) samples showed negative growth. The identification showed that out of forty one positive cultures, 32 isolates found as Candida albicans (78%), while nine samples (n=9) appeared as non-Candida albicans (22%) and found as Candida lusitaniae according to GTT and Vitek2 Compact identification. Then DNA was extracted from all non-Candida albicans isolates and DNA sequencing was carried and D1/D2 region were determined using NL1 primer. DNA based identification showed that all nine (n=9) GTT negative isolates were Candida lusitaniae (Anamorh Clavispora lusitaniae). This study documented that there are new emergent species of Candida should be considered when dealing with specimen collected from patients suspected for yeast infections. Our results provide useful information that C. lusitaniae can be isolated as well as other Candida species from immunocompromised patients in Sudan.



[1]  Blinkhorn, R. J., D. Adelstein, and P. J. Spagnuolo. 1989. Emergence of a new opportunistic pathogen, Candida lusitaniae. J. Clin. Microbiol. 27: 236-240.
[2]  Christenson, J. C., A. Guruswamy, G. Mukwaya, and P. Rettig. 1987. Candida lusitaniae: an emerging human pathogen. Pediatr. Infect. Dis. J. 6: 755-757.
[3]  Guinet, R., J. Chanas, A. Goullier, G. Bonnefoy, and P. Ambroise-Thomas. 1983. Fetal septicemia due to amphotericin B-resistant Candida lusitaniae. J. Clin. Microbiol. 18: 443-444.
[4]  Hadfield, T. L., M. B. Smith, R. E. Winn, M. G. Rinaldi, and C. Guerra. 1987. Mycosis caused by Candida lusitaniae. Rev. Infect. Dis. 9: 1006-1012.
[5]  Hazen, K. C. 1995. New and emerging yeast pathogens. Clin. Microbiol. Rev. 8: 462-478.
Show More References
[6]  Sanchez, V., J. A. Vazquez, D. Barth-Jones, L. Dembry, J. D. Sobel, and M. J.Zervos. 1992. Epidemiology of nosocomial acquisition of Candida lusitaniae. J. Clin. Microbiol. 30: 3005-3008.
[7]  Favel, A., Michel-Nguyen, A., Peyron, F. et al. (2003). Colony morphology switching of Candida lusitaniae and acquisition of multidrug resistance during treatment of a renal infection in a newborn: case-report and review of the literature. Diagnostic Microbiology and Infectious Disease 47, 331-9.
[8]  Pfaller, M. A., and D. J. Diekema. 2002. Role of sentinel surveillance of candidemia: trends in species distribution and antifungal susceptibility. J. Clin. Microbiol. 40: 3551-3557
[9]  Guinet, R., J. Chanas, A. Goullier, G. Bonnefoy, and P. Am-broise-Thomas (1983). Fatal septicemia due to amphotericin B-resistant Candida lusitaniae. J. Clin. Microbiol. 18: 443-444.
[10]  Merz, W. G., and G. R. Sandford (1979). Isolation and charac-terization of a polyene-resistant variant of Candida tropicalis. J. Clin. Microbiol. 9: 677-680.
[11]  Pappagianis, D., M. S. Collins, R. Hector, and J. Remington. (1979). Development of resistance to amphotericin B in Candida lusitaniae infecting a human. Antimicrob. Agents Chemother. 16: 123-126.
[12]  Holzschu, D. L., H. L. Presley, M. Miranda, and H. J. Phaff. (1979). Identification of Candida lusitaniae as an opportunistic yeast in humans. J. Clin. Microbiol. 10:202-205.
[13]  Van Uden, N., and H. Buckley. 1970. Candida Berkhout, p. 893-1087. In J. Lodder (ed.), The yeasts-a taxonomic study. North-Holland Publishing Co., Amsterdam.
[14]  Yoon, S. A., J. A. Vazquez, P. E. Steffan, J. D. Sobel, and R. A. Akins. 1999. High-frequency, in vitro reversible switching of Candida lusitaniae clinical isolates from amphotericin B susceptibility to resistance. Antimicrob. Agents Chemother. 43:836-845.
[15]  Nancy B. M., Haihua F., Ellen J. B.,1Ana C. G., Allison H., Richard J. H., and Michael A. Pfaller. (2002). Change in Colony Morphology of Candida lusitaniae in Association with Development of Amphotericin B Resistance. Antimicrob. Agents Chemother. 46: 1325-1328.
Show Less References


Isolation and Screening of Indigenous Bambara Groundnut (Vigna Subterranea) Nodulating Bacteria for their Tolerance to Some Environmental Stresses

1Department of Plant Biology, Faculty of Science, University of Douala, Douala, Cameroon

2Laboratory of Soil Microbiology, Biotechnology Centre, University of Yaounde I, Yaounde, Cameroon

3Department of Biological Sciences, University of Ngaoundere, Ngaoundere, Cameroon

4Department of Microbiology, Faculty of Science, University of Yaounde I, Yaounde, Cameroon

American Journal of Microbiological Research. 2015, 3(2), 65-75
DOI: 10.12691/ajmr-3-2-5
Copyright © 2015 Science and Education Publishing

Cite this paper:
Ngo Nkot Laurette, Ngo Bisseck Maxémilienne, Fankem Henri, Adamou Souleymanou, Kamguia Kamdem, Ngakou Albert, Nwaga Dieudonné, Etoa François-Xavier. Isolation and Screening of Indigenous Bambara Groundnut (Vigna Subterranea) Nodulating Bacteria for their Tolerance to Some Environmental Stresses. American Journal of Microbiological Research. 2015; 3(2):65-75. doi: 10.12691/ajmr-3-2-5.

Correspondence to: Ngo  Nkot Laurette, Department of Plant Biology, Faculty of Science, University of Douala, Douala, Cameroon. Email:


Environmental stresses are important limiting factors for crops production. The aim of this experiment is to isolate Legume Nodulating Bacteria (LNB) obtained from root nodules of bambara groundnut (Vigna subterranea L.) plants and evaluate their performance under some environmental constraints. Samples were collected in Cameroon from three location sites of the Humid-forest zone: Logbessou in the Littoral region; Mfoua in the South and Boga in the Centre region. Nodulation of bambara groundnut was examined in plastic bags and root nodules were collected from seedling. After their isolation, the bacteria were confirmed as LNB by re-nodulating Macroptilium atropurpureum. The morphological, cultural and phenotypic characteristics (utilization of carbon, tolerance to salt, pH, aluminium) of isolates were determined. The results obtained were analyzed statistically by ANOVA using the software SPSS analysis version 11.5. Duncan test was used to measure the difference among the means at a level of p<0.05. A collection of 18 isolates was obtained on Yeast Extract Mannitol Agar medium. Authentication experiments, confirmed that the majority of the isolates (66.67%) were LNB due to their ability to infect the host plant. Bambara groundnut isolates are different morphologically. Dendrogram of the phenotypic characteristics showed that, below the boundary level of 50% average similarity, isolates fell into at least three distinct groups. All isolates showed fast-growing capacity. Most isolates (66.67%) were able to grow in a medium with pH as low as and Al concentration of 50 µM (58.33 %). Some isolates (50%) showed weak growth capacity at 4% NaCl. The bambara groundnut isolates tested were able to use a broad range of carbohydrates as sole source of carbon. The isolates from the present study may be useful to increase the symbiotic nitrogen fixation in legume.



[1]  Adeparusi EO (2001). Effect of processing on some minerals, anti-nutrients and nutritional composition of African yam bean. J. Sustain. Environ. 3:101-108.
[2]  Allen ON, Allen EK (1981). The Leguminosae. A Source Book of Characteristics, Uses and Nodulation, The University of Wisconsin Press, 812 p.
[3]  Anderson, JM, Ingram JS (1993). Tropical soil biology and fertility: a hand book of methods. 2nd ed. C.A.B. International Wallingford, U.K. 171 p.
[4]  Appunu C, Reddy LML, Reddy CVCM, Sen D, Dhar B (2009). Symbiotic diversity among acid-tolerant bradyrhizobial isolates with cowpea. J. A. S. 4 (3): 126-131.
[5]  Arias A, Martı´nez-Drets G (1976). Glycerol metabolism in Rhizobium. Can. J. Microbiol. 22 (2): 150-153.
Show More References
[6]  Athar M, Johnson AD (1996) Nodulation, biomass production and nitrogen in alfalfa under drought. J. Plant Nutr. 19: 185-199.
[7]  Azam-Ali SN, Sesay A, Karikari SK, Massawe FJ, Aguilar-Manjarrez J, Brennan M, Hampson KJ (2001). Assessing the potential of an underutilised crop-a case study using bambara groundnut. Exp. Agric. 37: 433-472.
[8]  Bado BV (2002). Rôle des légumineuses sur la fertilité des sols ferrugineux tropicaux des zones guinéennes et soudaniennes du Burkina Faso. PhD thesis, Université Laval, Laval, Canada.
[9]  Bala A, Murphy PJ, Osunde AO, Giller KE (2003). Nodulation of tree legumes and the ecology of their native rhizobial populations in tropical soils. Appl. Soil Ecol. 22:211-223.
[10]  Bamshaiye OM, Adegbol, JA, Bamishaiye EI (2011). Bambara groundnut: an Under-Utilized Nut in Africa. Advances in Agricultural Biotechnology 1: 60-72.
[11]  BaoLing H, ChengQun L, Bo W, LiQin F (2007). A rhizobia strain isolated from root nodule of gymnosperm Podocarpus macrophyllus. Science in China Series C-Life Science 50: 1-6.
[12]  Bargaz A, Faghire M, Farissi M, Drevon JJ, Ghoulam C (2013). Oxidative stress in the root nodules of Phaseolus vulgaris L. is induced under conditions of phosphorus deficiency. Acta Physiol. Plant. 35: 1633-1644.
[13]  Belane AK, Dakora FD (2009). Measurement of N2 fixation in 30 cowpea (Vigna unguiculata L. Walp.) genotypes under field conditions in Ghana using 15N natural abundance technique. Symbiosis 48: 47-57.
[14]  Buendia-Claveria AM, Rodriguez-Navaro DN, Santamaria-Linaza C, Ruiz-Sainz JE, Temprano-Vera F (1994). Evaluation of the symbiotic properties of Rhizobium fredii in European soils. Syst. Appl. Microbiol. 17: 155-160.
[15]  Cheriet D, Ouartsi A, Chekireb D, Babaarbi S (2014). Phenotypic and symbiotic characterization of rhizobia isolated from Medicago ciliaris L. growing in Zerizer from Algeria. Afr. J. Microbiol. Res. 8 (17): 1763-1778.
[16]  Ciani M, Diriye FU (1995). Presence of rhizobia in soils of Somalia. Worl J. Microbiol. Biotechnol. 11:615-617.
[17]  Costa, FM, Schiavo JA, Brasi MS, Leite J, Xavier GR, Fernandes-Jr PI (2014). Phenotypic and molecular fingerprinting of fast growing rhizobia of field-grown pigeonpea from the eastern edge of the Brazilian Pantanal. Genet. Mol. Res. 13 (1): 469-482.
[18]  Dakora FD, Muofhe LM (1997). Nitrogen fixation and nitrogen nutrition in symbiotic bambara groundnut (Vigna subterranean (L.)Verdc.) and Kerting’s bean (Macrotyloma geocarpum (Harms) Marech et Baud.). In Heller J, Begemann F, Mushonga J (Eds.) Bambara Groundnut Vigna Subterranea (L.) Verdc: Proceedings of the Workshop on Conservation and Improvement of Bambara Groundnut (Vigna Subterranea (L.) at Harare, Zimbabwe. Bioversity International, pp 72-77.
[19]  Dogbe W, Fening JO, Kumaga FWK, Danso SKA (2002). Maximizing the benefits of using mucuna on farmers’mixed farming. Trop. Sci. 42: 87-91.
[20]  Egbe OM, Godwin Adu Alhassan GA, Ijoyah M (2013). Nodulation, Nitrogen Yield and Fixation by Bambara Groundnut (Vigna Subterranea (L.)Verdc.) Landraces Intercropped with Cowpea and Maize in Southern Guinea Savanna of Nigeria. Agricultural Science 1: 15-28.
[21]  ElSheikh EAE, Wood M (1989) Response of chickpea and soybean rhizobia to salt: Influence of carbon source, temperature and pH. Soil Biol. Biochem. 21: 883-887.
[22]  Essendoubi M, Brhada F, Eljamali, JE, Filali-Maltouf A, Bonnassie S, Georgeault S, Blanco C, Jebbar M (2007). Osmoadaptative responses in the rhizobia nodulating acacia isolated from south-eastern Moroccan Sahara. Environ. Microbiol. 9 (3): 603-611.
[23]  Faghire M, Bargaz A, Farissi M, Palma F, Mandri B, Lluch C, Tejera García NA, Herrera-Cervera JA, Oufdou K, Ghoulam C (2011). Effect of salinity on nodulation, nitrogen fixation and growth of common bean (Phaseolus vulgaris) inoculated with rhizobial strains isolated from the Haouz region of Morocco. Symbiosis 55: 69-75.
[24]  Fankem H, Tchuisseu Tchakounte GV, Ngo Nkot L, Nguesseu Njanjouo G, Nwaga D, Etoa FX (2014a). Maize (Zea mays) growth promotion by rock-phosphate solubilising bacteria isolated from nutrient deficient soils of Cameroun. Afr. J. Microbiol. Res. 8 (40): 3770-3579.
[25]  Fankem H, Ngo Nkot L, Nguesseu Njanjouo G, Tchuisseu Tchakounte GV, Tchiaze Ifoué A V, Nwaga D (2014b). Rock phosphate solubilisation by strains of Penicillium spp. Isolated from farm and forest soils of three ecological zones of Cameroon. Am. J. Agric. For. 2 (2): 25-32.
[26]  Farissi M, Ghoulam C, Bouizgaren A (2013). Changes in water deficit saturation and photosynthetic pigments of alfalfa populations under salinity and assessment of proline role in salt tolerance. Agric. Sci. Res. J. 3: 29-35
[27]  Farissi M, Bouizgaren A, Aziz F, Faghire M, Ghoulam C (2014). Isolation and screening of rhizobial strains nodulating alfalfa for their tolerance to some environmental stresses. Pacesetter J. Agric Sci. Res. 2 (2): 9-19.
[28]  Fasoyiro SB, Ajibade SR, Omole AJ, Adeniyan ON, Farinde EO (2006). Proximate, minerals and anti-nutritional factors of some underutilized grain legumes in south western Nigeria. Nutr. Food Science 36: 18-23.
[29]  Fening JO, Danso SKA (2002). Variation in symbiotic effectiveness of cowpea bradyrhizobia indigenous to Ghanaian soils. Appl. Soil Ecol. 21: 23-29.
[30]  Fernandes-Jr PI, Lima AA, Passos SR, Gava CAT (2012). Phenotypic diversity and amylolytic activity of fast growing rhizobia from pigeonpea [Cajanus cajan (L.) Millsp.]. Braz. J. Microbiol. 43: 1604-1612.
[31]  Freitas ADS, Borges WL, Andrade MMM, Sampaio EVSB, Santos CERS, Passos SR, Xavier GR, Mulato BM, Lyra MCCP (2014). Characteristics of nodule bacteria from Mimosa spp grown in soils of the Brazilian semiarid region. Afr. J. Microbiol. Res. 8 (8): 788-796.
[32]  Hillocks RJ, Bennett C, Mponda OM (2012). Bambara nut: A review of utlisation, market potential and crop improvement. Afr. Crop Sci. J. 20 (1): 1-16.
[33]  Hungria M, Vargas MAT (2000). Environmental factors affecting nitrogen fixation in grain legumes in the tropics with an emphasis on Brazil. Field Crops Res. 65: 151-164.
[34]  Jida M, Assefa F (2011). Phenotypic and plant growth promoting characteristics of Rhizobium leguminosarum bv. viciae from lentil growing areas of Ethiopia. Afr. J. Microbiol. Res.5: 4133-4142.
[35]  Johnston AWB, Beringer JE (1976). Pea root nodules containing more than one Rhizobium species. Nature 264:502-504.
[36]  Jordan DC (1984). Family III. Rhizobiaceae. In: Krieg NR, Holt JG. (Eds.) Bergey’s Manual of Systematic Bacteriology, Williams and Wilkins, Baltimore, pp 234-242.
[37]  Kishinevsky BD, Zur M, Friedman Y, Meromi G, Ben-Moshe E, Nemas C (1996). Variation in nitrogen fixation and yield in landraces of bambara groundnut (Vigna subterranea L.). Field Crop. Res. 48 (1): 57-64.
[38]  Klu GYP, Amoatey HM, Bansa D, Kumaeja FK (2001). Cultivation and use of African yam bean (Sphenostylis stenocarpa ex A Rich) in the Volta region of Chana. J. Food Technol. Africa 6: 74-77.
[39]  Kouninki H, Sobda G, Nukenine NE (2014). Screening of Bambara groundnut (Vigna subterranea) lines for Callosobruchus maculatus resistance in the Far North Region of Cameroon. Journal of Renewable Agriculture 2 (1): 18-22.
[40]  Küçük C, Kivanc M, Kinaci E (2006). Characterization of Rhizobium sp. Isolated from Bean. Turk. J. Biol. 30: 127-132.
[41]  Leite J, Seido SL, Passos SR, Xavier GR, Rumjanek NG, Martins LMV (2009). Biodiversity of rhizobia associated with cowpea cultivars in soils of the lower half of the São Francisco River Valley. R. Bras. Ci. Solo 33: 1215-1226.
[42]  Lyra MCCP, Freitas ADS, Silva TA, Santos CERS (2013). Phenotypic and molecular characteristics of rhizobia isolated from nodules of peanut (Arachis hypogaea L.) grown in Brazilian Spodosols. Afr. J. Biotechnol. 12: 2147-2156.
[43]  Maâtallah J, Berraho E, Sanjuan J, Lluch C (2002). Phenotypic characterization of rhizobia isolated from chickpea (Cicer arietinum) growing in Moroccoan soils. Agronomie, 22: 321-329.
[44]  Mbenoun LE (1992). Characterization of Bradyrhizobium sp of cowpea and bambara groundnut isolated from diverse agro-ecologic zones of Cameroon. MSc. dissertation, University of Yaounde, 65 p.
[45]  Mbenoun LE (1992). Caractérisation de Bradyrhizobium sp. du niébé et du poids bambara isolés de diverses zones agroécologiques du Cameroun. Mémoire de maîtrise, Université de Yaoundé. 65 p.
[46]  Missbah El Idrissi M, Abdelmoumen H (2008). Carbohydrates as carbon sources in rhizobia under salt stress. Symbiosis 46: 33-44.
[47]  Mohale KC, Belane AK, Dakora FD (2014). Symbiotic N nutrition, C assimilation, and plant water use efficiency in Bambara groundnut (Vigna subterranea L. Verdc) grown in farmers fields in South Africa, measured using 15N and 13C natural abundance. Biol. Fertil. Soils 50: 307-319.
[48]  Mpepereki S, Makonese F, Wollum AG (1997). Physiological characterization of indigenous rhizobia nodulating Vigna unguiculata in Zimbabwean soils. Symbiosis 22: 275-292.
[49]  Muthini M, Maingi JM, Muoma JO, Amoding A, Mukaminega D, Osoro N, Mgutu A, Ombori O (2014). Morphological assessment and effectiveness of indigenous rhizobia isolates that nodulate P. vulgaris in water hyacinth compost testing field in Lake Victoria Basin. Br. J. Appl. Sci. Tech. 4 (5): 718-738.
[50]  Ndiang Z, Bell JM, Missoup AD, Fokam PE, AmougouAkoa (2012). Etude de la variabilité morphologique de quelques variétés de voandzou (Vigna subterranea (L.) Verdc) au Cameroun. Journal of Applied Biosciences 60: 4410-4420.
[51]  Ngakou A, Megueni C, Ousseni H, Massai A (2009). Study on the isolation and characterization of rhizobia strains as biofertilizer tools for growth improvement of four grain legumes in Ngaoundéré-Cameroon. Int. J. Biol. Sci. 3 (5): 1078-1089.
[52]  Ngakou A, Ngo Nkot L, Doloum G, Adamou S (2012). Mycorrhiza-Rhizobium-Vigna subterranea dual symbiosis: impact of microbial symbionts for growth and sustainable yield improvement. Int. J. Agric. & biol. 14 (6): 915-921.
[53]  Ngo Nkot L, Nwaga D, Ngakou A, Fankem H, Etoa FX (2011). Variation in nodulation and growth of groundnut (Arachis hypogaea L.) on oxisols from land use systems of the humid forest zone in southern Cameroon. African Journal of Biotechnology 10 (20): 3996-4004.
[54]  Nyemba RC, Dakora FD (2010). Evaluating N2 fixation by food grain legumes in farmers’ fields in the three agro-ecological zones of Zambia, using 15N natural abundance. Biol. Fertil. Soils 46:461-470.
[55]  Padulosi S, Hodgkin T, Williams JT, Haq N (2002). Underutilized crops: trends, challenges and opportunities in the 21st Century. In: JMM Engels, VR Rao, AHD Brown, MT Jackson (eds) Managing plant genetic diversity. Wallingford, UK: CAB International Publishing; Rome: International Plant Genetic Resources Institute (IPGRI), pp 323-338.
[56]  Pule-Meulenberg F, Dakora FD (2009) Assessing the symbiotic dependency of grain and tree legumes on N2 fixation for their N nutrition in five agro-ecological zones of Botswana. Symbiosis 48: 68-77.
[57]  Rai R, , , (2012). Phenotypic and molecular characterization of indigenous rhizobia nodulating chickpea in India. Indian J. Exp. Biol. 50: 340-350.
[58]  Rodrigues CS, Laranjo M, Oliveira S (2006). Effect of heat and pH stress in the growth of chickpea mesorhizobia. Curr. Microbiol. 53 (1): 1-7.
[59]  Shetta ND, Al-Shaharani TS, Abdel-Aal M (2011). Identification and characterization of Rhizobium associated with woody legume trees grown under Saudi Arabia condition. Am. Eurasian J. Agric. Environ. Sci. 10 (3): 410-418.
[60]  Singh SK, Jaiswal, SK, Akhouri Vaishampayan, Dhar B (2013). Physiological behavior and antibiotic response of soybean (Glycine max L.) nodulating rhizobia isolated from Indian soils. Afr. J. Microbiol. Res. 7 (19): 2093-2102.
[61]  Somasegaran P, Hoben HJ (1994) Handbook for Rhizobia. Methods in Legume-Rhizobium Technology. New York: Springer-Verlag, pp 240-58.
[62]  Swift MJ, Bignell DE, Huang SP, Cares JE, Moreira F, Pereira EG, Nwaga D. Holt JA, Hauser S (2001). Standard methods for assessment of soil biodiversity and land use practice. In The ASA Review Meeting 1999, ASB Project, Bogor, Indonesia, ICRAF, Vol 1, 40 p.
[63]  The C (2000). Identification of heterotic groups for acids soil on some maize varieties in Cameroon. INCO 1 and 2 Meeting, June 2000. Yaoundé, Cameroon.
[64]  Torres-Júnior CV, Leite J, Santos CERS, Fernandes-Júnior PI, Zilli JE, Rumjanek NG, Xavier GR (2014). Diversity and symbiotic performance of peanut rhizobia from Southeast region of Brazil. Afr. J. Microbiol. Res. 8 (6): 566-577.
[65]  van Rossum D, Schuurmans FP, Gillis M, Muyotcha A, van Verseveld HW, Stotthamer AH, Boogerd FC (1995). Genetic and phenotypic analysis of Bradyrhizobium strains nodulating Peanut (Arachis hypogae L.) roots. Appl. Environ. Microbiol. 61: 1599-1609.
[66]  Vincent, JM (1970). A manual for practical study of root nodule bacteria. IBP Handbook No. 15, Blackwell Scientific Publishers, Oxford, 164p.
[67]  Vishal KD, Abhishek C (2014). Isolation and characterization of Rhizobium leguminosarum from root nodule of Pisum sativum L. J. Acad. Indus. Res. 2: 464-467.
[68]  Vriezen JAC, de Bruijn JF, Nusslein K (2007). Responses of rhizobia to desiccation in relation to osmotic stress, oxygen, and temperature. Appl. Environ. Microbiol. 73: 3451-3459.
[69]  Wolde-Meskel, E., Berg T., Peters N.K. and Frostegard, A. 2004. Nodulation status of native woody legumes and phenotypic characteristics of associated Rhizobia in soils of southern Ethiopia. Biol. Fert. Soils. 40: 55-66.
[70]  Yakubu H, Kwari JD, Ngala AL (2010). N2 fixation by grain legume varieties as affected by rhizobia inoculation in the sandy loam soil of sudano-sahelian zone of North Eastern Nigeria. Nig. J. Basic Appl. Sci. 18 (2): 229-236. Yang JK, Xie FI, Zhou Q, Zhou JC (2005). Polyphasic characteristics of bradyrhizobia isolated from nodules of peanut (Arachis hypogaea) in China. Soil Biol. Biochem. 37: 141-153.
[71]  Zabaloy MC, Gómez MA (2005). Diversity of rhizobia isolated from an agricultural soil in Argentina based on carbon utilization and effects of herbicides on growth. Biol. Fert Soils 42: 83-88.
[72]  Zahran HH (1999). Rhizobium-legume symbiosis and nitrogen fixation under severe conditions and in an arid climate. Microbiol. Mol. Biol. Rev. 63 (4): 968-989.
[73]  Zahran HH, Abdel-Fattah M, Yasser MM, Mahmoud AM, Bedmar EJ (2012). Diversity and environmental stress responses of rhizobial bacteria from Egyptian grain legumes. Aust. J. Bas. Appl. Sci. 6 (10): 571-583.
Show Less References


Prevalence and Resistance Profile of Acinetobacter baumannii Clinical Isolates from a Private Hospital in Khartoum, Sudan

1Department of Medical Microbiology Laboratory at RCIH

2Professor of Microbiology, Head of Microbiology Department at Royal Care International Hospital (RCIH) Khartoum, Sudan

3Department of Medical Microbiology Laboratory at Royal Care International Hospital (RCIH), Khartoum, Sudan

American Journal of Microbiological Research. 2015, 3(2), 76-79
DOI: 10.12691/ajmr-3-2-6
Copyright © 2015 Science and Education Publishing

Cite this paper:
Muntasir I. Omer, Samia A. Gumaa, Abdullatif A. Hassan, Khaled H. Idris, Osama A. Ali, Mustafa M. Osman, Mahmmoud S. Saleh, Nagla A. Mohamed, Mustafa M. Khaled. Prevalence and Resistance Profile of Acinetobacter baumannii Clinical Isolates from a Private Hospital in Khartoum, Sudan. American Journal of Microbiological Research. 2015; 3(2):76-79. doi: 10.12691/ajmr-3-2-6.

Correspondence to: Muntasir  I. Omer, Department of Medical Microbiology Laboratory at RCIH. Email:


Introduction: Acinetobacter baumannii is an important cause of nosocomial infections worldwide. It is difficult to control, and the infections caused by it are difficult to treat, because it is multidrug resistant. Objectives: This retrospective study was conducted to determine the prevalence and antibiotic resistance pattern of A. baumannii at Royal Care International Hospital, Khartoum, Sudan over a 37 month period. Methodology: Antimicrobial susceptibility testing of the isolates was performed by the disk diffusion method as recommended by Clinical Laboratory and Standards Institute CLSI [1]. Result: Non duplicate 275 A. baumannii were isolated out of a total 2899 pathogenic Gram negative isolates (9.5% prevalence). The most frequently isolated A. baumannii was from ICU patients (72%) followed by inpatients (24%) and outpatients (4%). The greatest number of isolates were recovered from sputum (61%) followed by wound (19%). The Resistance rates were higher than most of the internationally reported levels. Cephalosporins, aminoglycoside, aztreonam, fluoroquinolones and carbapenems are becoming practically ineffective, where the colistin elicited the highest susceptibility levels. Conclusion: This report shows for the first time (to our knowledge) the prevalence and resistance profile of A. baumannii in Sudan. The prevalence will help to conduct better infection control policy, and an update the local antibiogram will improve the knowledge of antimicrobial resistance patterns in our region.



[1]  Wayne, PA: Clinical and Laboratory Standards Institute; 2011. CLSI. Performance standards for antimicrobial susceptibility testing. 20th Informational Supplement. CLSI document M100-S21. Schreckenberger PC, Daneshvar MI, Weyant RS, Hollis DG. Acinetobacter, Achromobacter, Chryseobacterium, Moraxella, and other nonfermentative gram-negative rods. In: Murray PR, Baron EJ, Jorgensen JH, Pfaller MA, Yolken RH, editors. Manual of Clinical Microbiology. Washington, DC: ASM Press, 2007; 8: 770-779.
[2]  Fournier, P. E., D. Vallenet, V. Barbe, S. Audic, H. Ogata, L. Poirelet al., Comparative genomics of multidrug resistance in Acinetobacter baumannii. PLOS Genet. 2006; 10: 2-7.
[3]  Eveillard M, Soltner C, Kempf M, Saint-Andre J P, Lemarie C, Randrianarivelo C. et al,.The virulence variability of different Acinetobacter baumannii strains in experimental pneumonia. J Infect. 2010; 60 (2): 154-61.
[4]  Howard A, O'Donoghue M, Feeney A, Sleator RD. Acinetobacter baumannii: an emerging opportunistic pathogen. Virulence, 2012; 1: 3 (3): 243-50.
[5]  Kraniotaki E, Manganelli R, Platsouka E, Grossato A, Paniara O, Palù G. Molecular investigation of an outbreak of multidrug-resistant Acinetobacter baumannii, with char-acterisation of class 1 integrons. Int J Antimicrob Agents. 2006; 28: 193-9.
Show More References
[6]  Song JY, Kee SY, Hwang IS, Seo YB, Jeong HW, Kim WJ. et al., In vitro activities of carbapenem/sulbactam combination, colistin, colistin/rifampicin combination and tigecycline against carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother. 2007; 60 (2): 317-22.
[7]  Rello J. Acinetobacter baumannii infections in the ICU: customization is the key. Chest1999; 115: 1226-1229.
[8]  Rice, LB. Federal funding for the study of antimicrobial resistance in nosocomial pathogens: no ESKAPE. J Infect Dis. 2008; 197 (8): 1079-81.
[9]  Drummond, Katie. Pentagon to Troop-Killing Superbugs: Resistance Is Futile. Condé Nast. Retrieved 8 April 2013.
[10]  Manchanda V, Sanchaita S, and Singh NP. Multidrug Resistant Acinetobacter. J Glob Infect Dis.: 2010; 2 (3): 291-304.
[11]  Cisneros JM, Rodriguez-Bano J. Nosocomial bacteremia due to Acinetobacter baumannii: epidemiology, clinical features and treatment. Clin. Microbiol. Infect: 2002; 8: 687-69.
[12]  Shakibaie MR, Adeli S, Salehi MH. Antibiotic resistance patterns and extended-spectrum β-lactamase production among Acinetobacter spp. isolated from an intensive care Unit of a hospital in Kerman, Iran. Antimicrob Resist Infect Control: 2012; 1: 1-8.
[13]  Patwardhan RB, Dhakephalkar PK, Niphadkar KB, Chopade BA.A study on nosocomial pathogens in ICU with special reference to multiresistant Acinetobacter baumannii harboring multiple plasmids. Indian J Med Res: 2008; 128: 178-187.
[14]  AbdAllah S et al., Nosocomial infections and their risk factors at Mubarak Al-Kabeer hospital, Kuwait. Medical Journal of Cairo University, 2009, 78: 123-131.
[15]  Al Johani SM1, Akhter J, Balkhy H, El-Saed A, Younan M, Memish Z. Prevalence of antimicrobial resistance among gram-negative isolates in an adult intensive care unit at a tertiary care center in Saudi Arabia. Ann Saudi Med.: 2010; 30: 364-369.
[16]  Forbes BA, Sahm DF, Weissfeld AS. Bloodstream infections. In: Wilson L, editor. Bailey and Scott's Diagnostic Microbiology, 12 th ed. St Louis: The Mosby Company; 2007; 778-97.
[17]  Jaggi, Namita; Sissodia, Pushpa; Sharma, Lalit, Acinetobacter baumannii isolates in a tertiary care hospital: J Microbiol Infect Dis: 2012; 2 (2) p 57.
[18]  H. Siau, KY Yuen, SSY Wong. The epidemiology of Acinetobacter infections in Hongkong, J Med Microbiol 1996; 44: 340-347.
[19]  Endo S., Yano H., Hirakata Y., Arai K., Kanamori H., Ogawa M.,et al. Molecular epidemiology of carbapenem-non-susceptible Acinetobacter baumannii in Japan. J. Antimicrob. Chemother: 2012; 67 (7): 1623-1626.
[20]  Villers D, Espaze E, Coste-Burel M, Giauffret F, Ninin E, Nicolas F. et al,. Nosocomial Acinetobacter baumannii infections: Microbiological and clinical epidemiology. Ann Intern Med 1998; 129: 182-189.
[21]  Dijkshoorn, L, Nemec, A, Seifert, H. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol.: 2007; 12: 939-51.
[22]  Seifert H, Dolzani L, Bressan R, Van Der RT, van Strijen B, Stefanik D, Heersma H, et al,. Standardization and interlaboratory reproducibility assessment of pulsed-field gel electrophoresis-generated fingerprints of Acinetobacter baumannii. J ClinMicrobiol 2005; 43 (43) 28-35.
[23]  Wilks M, Wilson A, Warwick S, Price E, Kennedy D, Ely A, et al,. Control of an outbreak of multidrug-resistant Acinetobacter baumannii-calcoaceticus colonization and infection in an intensive care unit (ICU) without closing the ICU or placing patients in isolation. Inf Control HospEpidemiol, 2006; 27: 654-8.
[24]  Munoz-Price LS, Weinstein RA. Current concept: Acinetobacter Infection. N EnglJ Med 2008; 358: 1271-81.
[25]  Glow RH.,Moellering RC, Kunz LJ. Infections with Acinetobacter calcoaceticus (Herelleavaginicola): Medicine (Baltimore): 1977; 56: 79-97.
[26]  Evans BA, Hamoud, A, Towner S.A, Khan S.A, Amyes S.G. High prevalence of unrelated multidrug-resistant Acinetobacter baumannii isolates in Pakistani military hospitals. Int J Antimicrob Agents: 2011; 37: 580-581.
[27]  Dent L, Dana R M, Siddharth P. Multi-drug resistant Acinetobacter baumannii: a descriptive study in a city hospital. BMC Infectious Diseases: 2010; 10: 196-204.
[28]  Rit K, Saha R. Multidrug-resistant Acinetobacter infection and their susceptibility patterns in a tertiary care hospital. Niger Med J.: 2012; 53: 126-8.
[29]  Marchaim D, Chopra T, Pogue JM, Perez F, Hujer AM, Rudin S, et al,. Outbreak of colistin-resistant, carbapenem-resistant Klebsiella pneumoniae in metropolitan Detroit, Michigan. Antimicrob. Agents Chemother: 2011; 55 (2): 593-599.
[30]  Mammina C, Bonura C, Di Bernardo F, Aleo A, Fasciana T, Sodano al,. Ongoing spread of colistin-resistant Klebsiella pneumoniae in different wards of an acute general hospital, Italy, Euro Surveill: 2011; 17 (33): 20-48.
[31]  Lesho E, Yoon EJ, McGann P, Snesrud E, Kwak Y, Milillo M, et al. Emergence of colistin-resistance in extremely drug-resistant Acinetobacter baumannii containing a novel pmrCAB operon during colistin therapy of wound infections. J. Infect. Dis.: 2013; 208 (7): 1142-1151.
[32]  Lean SS, Suhaili Z, Ismail S, Rahman NI, Othman N, Abdullah FH, et al,. Prevalence and Genetic Characterization of Carbapenem-and Polymyxin-Resistant Acinetobacter baumannii Isolated from a Tertiary Hospital in Terengganu, Malaysia. ISRN Microbiology Vol 2014 (2014), Article ID 953417, 9.
Show Less References