American Journal of Microbiological Research

ISSN (Print): 2328-4129

ISSN (Online): 2328-4137

Website: http://www.sciepub.com/journal/AJMR

Current Issue» Volume 3, Number 1 (2015)

Article

Development of SCAR marker for Specific Detection of Trichoderma harzanium and Trichoderma viride

1Department of Biotechnology, College of Agriculture, Junagadh Agriculture University, Junagadh -362001, India

2Scientific Research Center, Biotechnology and Genetic Engineering Unit, Taif University, KSA

3Genetics Department, Faculty of Agriculture, Minufiya University, Egypt

4Microbiology Dept, MVM Science and Home Science College, Saurashtra University, Rajkot -360001, India


American Journal of Microbiological Research. 2015, 3(1), 45-49
DOI: 10.12691/ajmr-3-1-7
Copyright © 2015 Science and Education Publishing

Cite this paper:
H. J. Parmar, M. M. Hassan, N. P. Bodar, H .N. Lakhani, V. V. Umrania, B. A. Golakiya. Development of SCAR marker for Specific Detection of Trichoderma harzanium and Trichoderma viride. American Journal of Microbiological Research. 2015; 3(1):45-49. doi: 10.12691/ajmr-3-1-7.

Correspondence to: M.  M. Hassan, Scientific Research Center, Biotechnology and Genetic Engineering Unit, Taif University, KSA. Email: khyate_99@yahoo.com

Abstract

Trichoderma have been used as biological control agents against soil borne plant pathological fungi such as S. rolfsii. On this day molecular based techniques has been developed to detect T. harzanium using a fungus-specific marker derived from genomic DNA. An amplified RAPD product of 220 bp and 900 bp obtained in T. harzanium (NBAII Th 1) and T. viride (NBAII Tv 2) isolates, respectively. These two RAPD products were obtained using two random primers OPA-16 for harzanium (NBAII Th 1) isolate and OPC-05 for T. viride (NBAII Tv 2), thin RAPD products were sequenced. Based on sequences, one primers were designed, out of which a primer pair HAR220FP5 (CTTTTGGTTTGACACGGTTCT and HAR220RP5 (AAGCTTTGAAGTTGCGAGGA) amplified a sequence of 220 bp. and VIRI900FP7 (TACGCTCCAGGCTACCACTT) VIRI900RP7 (GAGATGAGCTCCTTGCTGCT) amplified a sequence of 900 bp. which was specific to T. harzianum and T. viride, respectively. The specificity of the marker when tested against six isolates of Trichoderma species showed a specific band of 220 bp. only in T. harzanium and a specific band of 900 bp. only in T.viride with the optimized PCR parameters. This sequence characterized amplified region (SCAR) marker was sensitive and could detect small quantities of Trichoderma DNA as low as 25 to 30 ng with high efficiency. This marker could also clearly distinguish T. harzianum and T. viride from other isolates of Trichoderma.

Keywords

References

[[[[[[[[[[[[[[[[[
[1]  Knudsen IMB, Jensen B, Jensen DF, Hockenhull J (1996) Occurrence of Gliocladium roseum on barley roots in sand and field soil. Kluwer Academic Publishers, Netherlands.
 
[2]  Seaby DA (1996) Differentiation of Trichoderma taxa associated with mushroom production. Plant Pathol 45: 905-912.
 
[3]  Shahid M, Singh A, Srivastava M, Srivastava DK (2014) Molecular Characterization of Trichoderma viride isolated from rhizospheric soils of uttar pradesh based on rDNA markers and analysis of their PCR-ISSR profiles. J Mol Biomark Diagn 5: 169.
 
[4]  Ospina-Giraldo MD, Royse DJ, Chen X, Romaine CP (1999) Molecular Phylogenetic Analyses of Biological Control Strains of Trichoderma harzianum and Other Biotypes of Trichoderma spp. Associated with Mushroom Green Mold. Phytopathology 89: 308-313.
 
[5]  Hassan M M (2014). Influence of protoplast fusion between Trichoderma spp. enhances extracellular enzymes and antagonistic activity against some soil pathogens. Biotechnology and biotechnological equipments, 28: 1014-1023.
 
Show More References
6]  Hassan M M, A Gaber and E I. El-Hallous (2014) Molecular and Morphological Characterization of Trichoderma harzianum from different Egyptian Soils, Wulfenia Journal, 21: 80-96.
 
7]  Hermosa, M. R., Grondona, I., Iturriaga, E. A., Dia-MinGuez, Castro, C., Monte, E. and Garcia-Acha, I. 2000. Molecular characterization and identification of biocontrol isolates of Trichoderma spp. Applied and Env. Microbiology. 66 (5): 1890-1898.
 
8]  Venkateswarulu, R., Reddi Kumar, M., Eswara Reddy, N. P. and Sudhakar, P. 2008. Molecular characterization of Trichoderma spp. used against Fusarium wilt with PCR based RAPD and ITS-PCR. J. Mycology and Plant Pathology. 38 (3): 559-563.
 
9]  Abbasi P. A., Miller S. A., Mealia T., Hoitink H. A. J., and Kim J. M. (1999). Precise detection and tracing of Trichoderma hamatum 382 in compost amended potting mixes by using molecular markers. Appl. Environ. Microbiol. 12: 5421-5426.
 
10]  Lecomte P, Peros JP, Blancard D, Bastien N, Delye C (2000). PCR assays that identify the grapevine dieback fungus Eutypa lata. Appl. Environ. Microbiol. 66: 4475-4480.
 
11]  Li KN, Rouse DI, Eyestone EJ, German TL (1999). The generation of specific DNA primers using random amplified polymorphic DNA and its application to Verticillium dahliae. Mycol. Res. 103: 1361-1368.
 
12]  Schilling AG, Moller EM, Geiger HH (1996). Polymerase chainreactionbased assays for species-specific detection of Fusarium culmorum, F. graminearum, and F. avenaceum. Phytopathol. 86: 515-522.
 
13]  Watanabe N (1984) Bulletin of Faculty of Agriculture, Maiji University, Japan 66: 45.
 
14]  Doyle J. J, Doyle J. L (1987) .A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull .19: 11-15.
 
15]  Shalini 1, Narayan, K. P. 1, Lata1 and Kotasthane, A. S. (2006). Genetic relatedness among Trichoderma species inhibiting a pathogenic fungi Rhizoctonia solani. African Journal of Biotechnology Vol. 5 (8), pp. 580-584.
 
16]  Sneath, P. H. A. and Sokal, R. R. (1973). Numerical Taxonomy: The Principles and Pratice of Numerical Classification. San Francisco: Freeman, 573 pp.
 
17]  Lieckfeldt, G.J. Samuels, H.I. Nirenberg, O. Petrini A. (1999). morphological and molecular perspective of Trichoderma viride: is it one or two species Appl. Environ. Microbiol. 65: 2418-2428.
 
18]  Kandoliya U.K. and D. N. Vakharia (2013) Antagonistic effect of Pseudomonas fluorescens against fusrium oxysporum f.sp. Ciceri causing wilt in chickpea. Legume Research., 36 (6) 569-575.
 
19]  Zimand, G., Valinsky, L., Elad, Y., Chet, I., Manualis, S. (1994). Use of RAPD procedure for the identification of Trichoderma species. Mycol. Res. 98, 531-534.
 
20]  Bulat, S. A., Lubeck, M., Mironenko, N. V., Jensen, D. F., Lubeck, P. S. (1998). UPPCR analysis and ITS1 ribotyping of Trichoderma and Gliocladium fungi. Mycol. 102: 933-943.
 
21]  Cumagun CJR, Hockenhull J, Lübeck M (2000) Characterization of Trichoderma isolates from Philippine rice fields by UP-PCR and rDNA-ITSI analysis: identification of UP-PCR markers. Journal of Phytopathology 148: 109-115.
 
22]  Naeimi, S. (2010). Development of a specific molecular marker for detection of the most effective Trichoderma strain against Than at ephoruscucumeris, the causal agent of rice sheath blight disease. Ph.D thesis, Faculty of Agriculture, University of Tehran, Karaj, Iran.
 
Show Less References

Article

Evaluation of the Degree of Contamination of Salad Vegetables Sold in Umuahia Main Market

1Department of Microbiology, College of Natural Sciences, Michael Okpara University of Agriculture Umudike, Abia State, Nigeria.


American Journal of Microbiological Research. 2015, 3(1), 41-44
DOI: 10.12691/ajmr-3-1-6
Copyright © 2015 Science and Education Publishing

Cite this paper:
Nwankwo. I.U, Eze. V.C, Onwuakor. C.E, Friday. J.U. Evaluation of the Degree of Contamination of Salad Vegetables Sold in Umuahia Main Market. American Journal of Microbiological Research. 2015; 3(1):41-44. doi: 10.12691/ajmr-3-1-6.

Correspondence to: Onwuakor.  C.E, Department of Microbiology, College of Natural Sciences, Michael Okpara University of Agriculture Umudike, Abia State, Nigeria.. Email: chijiokeonwuakor@gmail.com

Abstract

The evaluation of the degree of contamination of salad vegetables sold in Umuahia main market was carried out. Six Samples of salad vegetables (Cabbage, Carrot, Cucumber, Onions, Green peas and Green beans) sold around the market were analyzed. Total viable counts ranged from 2.35 x 105 to 9.50 x 105 cfu/ml with highest incidence seen in cabbage and onions sold by vendor A. 86.66% of cabbage samples were contaminated, with the least incidence seen in green bean (33.33%). Six bacterial and five fungal species were isolated. The isolates include: Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Bacillus sp, Enterobacter sp and Proteus sp. and the fungal isolates were Aspergillus sp. Yeast, Cladosporium sp. Penicillium sp. and Rhizopus sp. These results indicates that street vended salad vegetables where contaminated to an extent, and therefore, needs vigorous washing with safe running water before consuming to avoid food borne diseases associated with consumption of contaminated food.

Keywords

References

[[[[[[[[[[
[1]  Harli, V. and Franca, B. Fruits and Vegetables International Agency for Research on Cancers (IARC) Report 2, 2003.
 
[2]  Beuchat, L.R and Larry, R. Pathogenic Microorganism Associated with Fresh Produce. Journal of Food Protection 13:204-216. 2000.
 
[3]  Prigulkar, K.A., Kamat, O and Bougiruwar, D. Microbiology Quality of Fresh Leafy Vegetables, Salad Components and Ready to Eat Salads. Int. J. Food Science Nutrition 52: 15-23. 2000.
 
[4]  Beuchat, L.R Ecological Factor Influencing Survival and Growth of Human Pathogens on Raw Fruits and Vegetables Microb. Infection 4 (4): 413-423. 2002.
 
[5]  Liu, D. Identification, Sub typing and Virulence Determination of Listeria Monocytogenes, an Important Food Borne Pathogens. J. Med. Microbiol 55 (6): 645-659. 2006.
 
Show More References
6]  Kalia, A. and Gupta, R.P. Fruit Microbiology. In: Hui Y.H.J., Cano, M.P., Gusek, W., Sidhu, J.W., Sinha, N.K. Handbook of Fruit and Fruit Processing. 1st Edt. Blackwell Publishing, 2006, 3-28.
 
7]  Carmo, L.S., Cumnings, C., Lenardi, V.R., Dias, R.S., Souza, J.M., Sena, M.J., Santos, D.A., Shupp, J.W., Pereira, R.K., Jett, M. A Case Study of a Massive Staphylococcal Food Poisoning Incident Food Borne Pathog. Dis 1:241-246. 2004.
 
8]  Ray, B. and Bhunia, A.K. Fundamental Food Microbiology 4th Edt. CRC Press. U.S.A. 2007, 4-13.
 
9]  Ofor, M.O., Okorie, V.C., Ibeawuchi, U., Ihejirika, G.O., Obilo, O.P., and Dialoka, S.A. Microbial Contaminant in Fresh Tomato Wash Water and Food Safety Consideration in South-Eastern Nigeria. Life Science J. 1:80-82. 2009.
 
10]  Vishwanathan, P. and Kaur, R. Prevention and Growth of Pathogens on Salad Vegetables, Fruits and Sprouts. Intl. J. Hyg. Environ. Health 203: 205-213. 2000.
 
11]  Beuchat, L.R Pathogenic Microorganisms Associated with Fresh Produce Journal of Food Protection 59: 204-216. 1996.
 
12]  Vanderzant, C. and Splittoeser, D.F. Compendium of Methods for the Microbiological Examination of Foods Washington D.C. American Health Association, 1992, 44-61.
 
13]  Beuchat, L.R and Brackelt, R.E. Survival and Growth of Listeria monocytogens on Lettuce as Influenced by Shredding, Chlorine Treatment, Modified, Packaging and Temperature Journal of Food Protection 55 (3): 755-758. 1998.
 
14]  Leus, J., Venter, P. Westhuizen, J., and Vander, H., Enumeration of Potential Microbiology Hazards in Milk from a Marginal Urban Settlement in Central South Africa. Food Microbiology 321-326. 2002.
 
15]  Bean, N.H. and Griffin, P.M. Food Borne Disease Outbreaks in the United States 1973-1987: Pathogens, Vehicles and Trends Journal of Food Protection 53: 807-814. 1992.
 
Show Less References

Article

Antibodies to Echinococcus granulosus Egg Antigens in Hydatid Patients: Characterization by Immunoblot and Diagnostic Value

1Laboratory of Immunology, Institut Pasteur de Tunis, Tunis, TUNISIA


American Journal of Microbiological Research. 2015, 3(1), 33-40
DOI: 10.12691/ajmr-3-1-5
Copyright © 2015 Science and Education Publishing

Cite this paper:
Wissal IRAQI HOUSSAINI. Antibodies to Echinococcus granulosus Egg Antigens in Hydatid Patients: Characterization by Immunoblot and Diagnostic Value. American Journal of Microbiological Research. 2015; 3(1):33-40. doi: 10.12691/ajmr-3-1-5.

Correspondence to: Wissal  IRAQI HOUSSAINI, Laboratory of Immunology, Institut Pasteur de Tunis, Tunis, TUNISIA. Email: w.iraqi@gmail.com

Abstract

Cystic echinococcosis/hydatidosis, caused by Echinococcus granulosus, is a chronic zoonotic larval cestode infection in humans. Human hydatidosis is a public health parasitic disease that is cosmopolitan in its distribution. Several years may last between contamination with E. granulosus eggs and development of symptomatic cysts. Antigens expressed by embryos at early differentiation steps between the embryo and the young cyst may be interesting as markers of early infection or reinfection. This study investigates antibody response (IgG) to E. granulosus egg antigens by Immunoblot (IB) and ELISA in 20 hydatid patients surgically confirmed. We have also tested sera using protoscoleces and hydatid cyst fluid (HCF) from E. granulosus. The results show that hydatid patients reacted to eggs as well as protoscoleces and HCF. However, eggs share antigens in common with other life-cycle stages, but also support the notion that they may possess some unique stage-specific antigens determinants. The possible functional significance and the potential use of combined assessment of these antigens in IB with Ig G response in ELISA are discussed.

Keywords

References

[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[
[1]  World Heath Organisation. Echinococcosis. WHO Factsheet. 2013. N° 37.
 
[2]  Kilani M, Darghouth M, Lahmar S, Jaoua H and Jemli, M. Rôle du chien dans l’épidémiologie du kyste hydatique en Tunisie. La Tunisie Médicale, 1986; 64: 333-337.
 
[3]  Kilani M, Lahmar S, Jemli MH, Darghouth MA, Jomaa I, Diouani F, Ben Miled L, Iraqi W and Ben Ismail R. Prevalence of Echinococcus granulosus in captured dogs in Tunisia (parasitic necropsy). XVIII international congress of Hydatidology. 1997 ; Novembrer; Lisbonne-Portugal.
 
[4]  Anonymous. L’incidence chirurgicale de l’hydatidose en Tunisie (1988-1992). Rapport de la Direction des Soins et de Santé de Base, Tunis-Tunisie-Ministère de la santé publique. 1993.
 
[5]  Teggi A. An up-to-date on clinical management of human cystic echinococcosis. Parasitologia. 2004; Dec; 46 (4): 405-7.
 
Show More References
6]  Wen H, New RRC, Craig PS. Diagnosis and treatement of human hydatidosis. British Journal of Clinical Pharmacology. 1993; 35: 565-574.
 
7]  Lahmar S, Rebaï W, Boufana BS, Craig PS, Ksantini R, Daghfous A, Chebbi F, Fteriche F, Bedioui H, Jouini M, Dhibi M, Makni A, Ayadi MS, Ammous A, Kacem MJ, Ben Safta Z. Cystic echinococcosis in Tunisia: Analysis of hydatid cysts that have been surgically removed from patients. Annals of Tropical Medecine and Parasitology. 2009 October, 103 (7): 593-604.
 
8]  M'rad S, Oudni-M'rad M, Boubaker G, Bouazzi L, Gorcii M, Nouri A, Mezhoud H, Babba H. Retrospective study of the distribution and the fertility of hydatid cysts in the child in Tunisia. Pathologie Biologie (Paris). 2012; Jun; 60 (3): 166-9.
 
9]  Lahmar S, Trifi M, Ben NaceurS, Bouchhima T, Lahouar N, Lamouchi I, Maâmouri N, Selmi R, Dhibi M, Torgerson PR. Cystic echinococcosis in slaughtered domestic ruminants from Tunisia. Journal of Helminthology. 2013; September, 87(3): 318-25.
 
10]  Lahmar S, Boufana BS, Inoubli S, Guadraoui M, Dhibi. M, Bradshaw H, Craig PS. Echinococcus in the wild carnivores and stray dogs of northern Tunisia: the results of a pilot survey. Annals of Tropical Medecine and Parasitology. 2009; 103 (4): 323-31.
 
11]  M'rad S, Oudni-M’rad M, Filisetti D, Mekki M, Nouri A, Sayadi T, Candolfi E, Azaiez R, Mezhoud H, Babba H. Molecular identification of Echinococcus granulosus in Tunisia: First record of the Buffalo Strain (G3) in Human and Bovine in the Country. The Open Veterinary Science Journal. 2010; 4: 27-30.
 
12]  Piantelli M, Pozzuoli R, Aru E, Musiani P. Echinococcus granulosus: Identification of subunits of the major antigens. Journal of Immunology. 1977; 119: 1382-1386.
 
13]  Rickard MD, Lightowlers MW. Immunodiagnosis of hydatid disease. In : The biology of Echinococcus granulosus and hydatid disease (editor: R.C.A. Thompson). 1986. Georges Allen & Unwin, London: 217-249.
 
14]  Lightowlers MW, Liu D, Haralambous A, Rickard MD. Subunit composition and specificity of the major cyst fluid antigen of Echinococcus granulosus. Molecular and Biochemical Parasitology. 1989; 37: 171-182.
 
15]  Chamekh M, Facon B, Dissous C, Haque A, Capron A. Use of monoclonal antibody specific for a protein epitope of Echinococcus granulosus antigen 5 in a competitive antibody radioimmunoassay for diagnosis of hydatid disease. Journal of Immunological Methods. 1990; 134: 129-137.
 
16]  Varela-Diaz VM, Guisantes JA, Ricardes MI, Yarzabal LA, Coltorti EA. Evaluation of whole and purified hydatid fluid antigens in the diagnosis of human hydatidosis by the immuno-electrophoresis test. American Journal of Tropical Medicine and Hygiene. 1975; 24: 298-303.
 
17]  Yarzabal LA, Dupa H, Bout DT, Naquira FR, Capron AR. Echinococcus granulosus: The distribution of hydatid fluid antigens in the tissue of the larval stage. II: Localisation of the thermostable lipoprotein of parasitic origin (Antigen B). Experimental Parasitology. 1977; 42: 115-120.
 
18]  Shephered JC, McManus DP. Specific and cross-reactive antigens of Echinococcus granulosus hydatid cyst fluid. Molecular and Biochemical Parasitology. 1987; 25: 143-154.
 
19]  Maddison SE, Slemenda SB, Shantz PM, Fried JA, Wilson M, Tsang VCW. A specific diagnosis antigen of Echinococcus granulosus with an apparent molecular weight of 8 kDa. American Journal of Medecine and Hygiene. 1989; 40: 377-383.
 
20]  Siracusano A, Ioppolo S, Notargiacomo S, Ortona E, Rigano R, Teggi A, De Rosa F, Vicari G. Detection of antibodies against Echinococcus granulosus major antigens and their subunits by immunoblotting. Transactions of the Royal Society of Tropical Medecine and Hygiene. 1991; 85: 239-243.
 
21]  Leggatt GR, McManus DP. Identification and diagnostic value of a major antibody epitope on the 12 kDa antigen from Echinococcus granulosus (hydatid disease) cyst fluid. Parasite Immunology. 1992; 16: 87-96.
 
22]  Riganò R, Profumo E, Bruschi F, Carulli G, Azzarà A, Ioppolo S, Buttari, B, Ortona E, Margutti P, Teggi, A, Siracusano, A. Modulation of human immune response by Echinococcus granulosus Antigen B and its possible role in evading host defenses. Infection and Immunity. 2001; Jan; 69(1): 288–296.
 
23]  Craig PS, Rickard MD. Antibody responses of experimentally infected lambs to antigens collected during in vitro maintenance of the adult, metacestode or oncosphere stages of Taenia hydatigena and Taenia ovis with further observations on anti-oncospheral antibodies. Journal of Parasitology. 1982; 67: 197-209.
 
24]  Craig PS, Rickard MD. Anti-oncospheral antibodies in serum of lambs experimentally infected with either Taenia ovis or Taenia hydatigena. Journal of Parasitology. 1981; 64: 169-177.
 
25]  Craig PS, Macpherson CNL, Nelson GS. The identification of eggs of Echinococcus by Immunofluorescence using a specific anti-oncospheral monoclonal antibody. American Journal of Medicine and Hygiene. 1986; 35 (1): 152-158.
 
26]  Rogan MT, Craig PS. Zehyle E, Masinde G, Wen H, Zhou P. In vitro killing of taeniid oncospheres mediated by human sera from hydatid endemic areas. Acta Tropica. 1992; 51: 291-296.
 
27]  Heath DD, Lawrence SB. Antigenic polypeptides of Echinococcus granulosus oncospheres and definition of protective molecules. Parasite Immunology. 1996; 18: 347-357.
 
28]  Lightowlers MW, Lawrence SB, Gauci CG, Young J, Ralston MJ, Maas D, Heath DD. Vaccination against hydatidosis using a defined recombinant antigen. Parasite Immunology. 1996; 18: 457-462.
 
29]  Lowry OH, Rosbrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. The Journal of Biological Chemistry. 1951; 193: 265-275.
 
30]  Laemmli UK. Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature. 1970; 227: 680-685.
 
31]  Towbin H, Staehlin T, Gordan J. Electrophoretic transfer of protein from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proceedings of the National Academy of Sciences of the USA. 1979; 76: 4350-4354.
 
32]  Yarzabal LA, Dupas H, Bout DT, Capron AR. Echinococcus granulosus: The distribution of hydatid fluid antigens in the tissue of the larval stage. I: Localisation of the specific antigen of hydatid fluid (antigen 5). Experimental Parasitology. 1976; 40: 391-396.
 
33]  Moro PL, Bonifacio N, Gilman RH, Lopera L, Silva B, Takumoto R, Verastegui M, Cabrera L. Field diagnosis of Echinococcus granulosus infection among intermediate and definitive hosts in an endemic focus of human cystic echinococcosis. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1999; November-December; 93(6): 611-5.
 
34]  Heath DD. The migration of oncospheres of Taenia pisiformis, Taenia serialis and Echinococcus granulosus within the intermediate host. International Journal for Parasitology. 1971; 1: 145-152.
 
35]  Rausch RL. Studies on the helminth fauna of Alaska. The histogenesis of the alveolar larvae of Echinococcus species. Journal of Infectious Diseases. 1954; 94: 178-186.
 
36]  Sakamoto T, Sugimura M. Electron microscopical observations on histogenesis of larval Echinococcus multilocularis. Japanese Journal of Veterinary Research. 1970, 18: 131-144.
 
37]  Heath DD, Lawrence SB. Echinococcus granulosus: development in vitro from oncosphere to immature hydatid cyst. Parasitology. 1976; 73: 417-423.
 
38]  Alvarez Rojas CA, Romig T, Lightowlers MW. Echinococcus granulosus sensu lato genotypes infecting humans--review of current knowledge. International Journal of Parasitology. 2014; January; 44(1):9-18.
 
39]  Pini C, Pastore R, Valesnin G. Circulating immune complexes in sera of patients infected with Echinococcus granulosus. Clinical and Experimental Parasitology. 1983; 51: 572.
 
40]  Richard-Lenoble D, Smith MD, Loisy M, Verroust PJ. Human hydatidosis: Evaluation of three serodiagnostic methods, the principal subclass of specific immunoglobulin and the detection of immune complexes. Annals of Tropical Medecine and Parasitology. 1978; 72: 553-560.
 
41]  Marinova I, Nikolov G, Michova, Kurdova AR, Petrunov B. Quantitative assessment of serum-specific IgE in the diagnosis of human cystic echinococcosis. Parasite Immunology, 2011; 33 (7): 371-376.
 
42]  Craig PS, Nelson GS. The detection of circulating antigen in human hydatid disease. Annals of tropical Medecine and Parasitology. 1984; 78 (3): 219-227.
 
43]  Kanwar JR, Vinayak VK.. The significance of free and immune-complexed hydatid specific antigen(s) as an immunodiagnostic tool for human hydatidosis. Journal of Medical Microbiololgy. 1992; 396-403.
 
44]  Craig PS. Detection of specific circulating antigen, immune complexes and antibodies in human hydatidosis from Turkana (Kenya) and Great Britain, by enzyme-immunoassay. Parasite Immunology. 1986; 8 (2): 171-188.
 
45]  Gottstein B. An immunoassay for the detection of circulating antigens in human echinococcosis. American Journal of Medicine and Hygiene. 1984; 33: 1185-1191.
 
46]  Purriel P, Shantz PM, Bevoide H, Mendoza G. Human echinococcosis in Uruguay: A comparison of indices of morbidity and mortality. Bulletin of the World Health Organisation. 1973; 49: 395-402.
 
47]  Bonifacino R, Malgor R, Barbeito R, Balleste R, Rodriguez J, Botto C, klug F. Seroprevalence of Echinococcus granulosus infection in a Uruguayan rural human population. Transactions of the Royal Society of Tropical Medecine and Hygiene. 1991; 85: 769-772.
 
48]  Maizels RM. Infections and allergy-helminths, hygiene and host immune regulation. Current Opinion in Immunology, 2005; 17 (6): 656-661.
 
49]  Leggatt GR, Yang W, McManus DP. Serological evaluation of the 12 kDa subunit of antigen B in Echinococcus granulosus cyst fluid by immuno-blot analysis. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1992; 86: 189-192.
 
50]  Profumo E, Ortona E, Rigano R, Gioia I, Notargiacomo S, Ippolo S, Siracusano A. Cellular and humoral responses to antigenic subunit of Echinococcus granulosus cyst fluid in hydatid patients. Parasite Immunology. 1994; 16: 393-398.
 
51]  Delunardo F, Ortona E, Margutti P et al.. Identification of a novel 19 kDa Echinococcus granulosus antigen. Acta Tropica, 2010; 113 (1): 42-47, 2010.
 
52]  Daeki AO, Craig PS, Shambesh MK. IgG-subclass antibody responses and the natural history of hepatic cystic echinococcosis in asymptomatic patients. Annals of Tropical Medicine and Parasitology, 2000; 94 (4): 319-328.
 
53]  Moro PL, Garcia HH, Gonzales AE, Bonilla JJ, Verastegui M, Gilman RH. Screening for cystic echinococcosis in an endemic region of Peru using portable ultrasonography and the enzyme-linked immunoelectrotransfer blot (EITB) assay. Parasitology Research, 2005; 6 (4): 242-246.
 
54]  Allen JE, Maizels RM. Diversity and dialogue in immunity to helminthes. Nature Reviews Immunology, 2011; 1: 375-388.
 
Show Less References

Article

Development of an in Vitro Novel Device that Simulates the Real Life of the Biofilm Formation on Catheters under both Static and Continuous Fluid Flow Systems

1Department of Microbiology, Immunology and Biotechnology, Faculty of Pharmacy and Biotechnology, German University in Cairo, GUC, New Cairo City, Egypt


American Journal of Microbiological Research. 2015, 3(1), 25-32
DOI: 10.12691/ajmr-3-1-4
Copyright © 2015 Science and Education Publishing

Cite this paper:
Mohamed El-Azizi. Development of an in Vitro Novel Device that Simulates the Real Life of the Biofilm Formation on Catheters under both Static and Continuous Fluid Flow Systems. American Journal of Microbiological Research. 2015; 3(1):25-32. doi: 10.12691/ajmr-3-1-4.

Correspondence to: Mohamed  El-Azizi, Department of Microbiology, Immunology and Biotechnology, Faculty of Pharmacy and Biotechnology, German University in Cairo, GUC, New Cairo City, Egypt. Email: mohamed.el-azizi@guc.edu.eg

Abstract

Biofilm model systems are essential to explore the development and the nature of the microbial community within the biofilm as well as the mechanism of their resistance. The aim of this work is to develop a simple in vitro novel device which mimics the real life of the biofilm formation and could be modulated to contain most catheter and tubes and readily allows biofilm formation under different experimental conditions. Two clinical isolates, Staphylococcus epidermidis and Candida albicans, were used to validate the device. The viability of the microorganisms within the biofilm was demonstrated quantitatively by viable count and semi-quantitively by using Scanning Electron Microscope and Confocal Scanning Laser Microscope. The shear stress on the inner and outer surfaces of the catheter was determined at different flow rates of the culture medium. The presented device supports biofilm formation of the tested microorganisms under static and dynamic fluid flow systems. The results are comparable to that of other biofilm models. The number of cells contained in the biofilm under static system was significantly higher than that of the biofilm which formed under dynamic system for both microorganisms. For S. epidermidis, the log value of the number of cells contained in the biofilm under static system was 6.41 ± 0.22 compared to 5.18 ±0.13 of the biofilm which formed under continuous fluid flow system (p < 0.001). For C. albicans, the log value of the number of adherent cells was 6.44 ± 38 and 5.47 ± 0.05 respectively (p = 0.012). The presented well suited to study the real life of the biofilm formation by microorganisms. It enables the formation of a reproducible biofilm of bacteria and yeast on the catheter surface in both static and dynamic systems and its design permits low laminar flow system.

Keywords

References

[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[
[1]  Prosser, P.L., Taylor, D., Dix B.A. and Cleeland, R, “Method of evaluating effects of antibiotics on bacterial biofilm,” Antimicrob Agents Chemother, 31(10). 1502-1506. Oct.1987.
 
[2]  El-Azizi, M., Rao, S., Kanchanapoom, T. and Khardori N, “In vitro activity of vancomycin, quinupristin/dalfopristin, and linezolid against intact and disrupted biofilms of staphylococci,” Ann Clin Microbiol Antimicrob, 4(2). Jan. 2005 [Online].
 
[3]  Johnson, G.M., Lee, D.A., Regelmann, W.E., Gray, E.D., Peters, G. and Quie, P.G, “Interference with granulocyte function by Staphylococcus epidermidis slime,” Infect Immun, 54(1). 13-20. Oct.1986.
 
[4]  Coenye, T. and Nelis, H.J, “In vitro and in vivo model systems to study microbial biofilm formation,” J Microbiol Methods, 83(2). 89-105. Nov.2010.
 
[5]  Pavarina, A.C., Dovigo, L.N., Sanita, P.V., Machada, A. L., Giampaolo, E.T. and Vergani, C.E, Biofilm formation: development and properties, Nova Science Publishers Inc., New York, 2011, 125-162.
 
Show More References
6]  Andes, D., Nett, J., Oschel, P., Albrecht, R., Marchillo, K. and Pitula, A, “Development and characterization of an in vivo central venous catheter Candida albicans biofilm model,” Infect Immun, 72(10). 6023-6031.Oct.2004
 
7]  Freire, M.O., Sedghizadeh, P.P., Schaudinn, C., Gorur, A., Downey, J.S., Choi, J.H., Chen, W., Kook, J.K., Chen, C.,Goodman, S.D. and Zadeh, H.H, “Development of an animal model for Aggregatibacter Actinomycetemcomitans biofilm-mediated oral osteolytic infection: A preliminary study,” J Periodontol, 82(5). 778-789. May 2011.
 
8]  Williams, D.L. and Costerton, J.W, “Using biofilms as initial inocula in animal models of biofilm-related infections,” J Biomed Mater Re, 100(4). 1163-1169.May 2012.
 
9]  Harraghyi, N., Seiler, S., Jacobs, K., Hannig, M., Menger, M.D. and Herrmann, M, “Advances in in vitro and in vivo models for studying the staphylococcal factors involved in implant infections,” The International Journal of Artificial Organs, 29(4). 368-378. Apr. 2006.
 
10]  Christensen, G.D., Simpson, W.A., Younger, J.J., Baddour, L.M., Barrett, F.F. and Melton, D.M, “Adherence of coagulase negative staphylococci to plastic tissue culture plates: A quantitative model for the adherence of staphylococci to medical devices,” J Clin Microbiol, 22(6). 996-1006. Dec. 1985.
 
11]  Stepanovic, S., Vukovic, D., Dakic, I., Savic, B. and Svabic-Vlahovic, M, “A modified microtiter-plate test for quantification of staphylococcal biofilm formation,” J Microbiol Methods, 40(2). 175-179. Apr. 2000.
 
12]  Mack, D., Siemssen, N. and Laufs, R, “Parallel induction by glucose of adherence and a polysaccharide antigen specific for plastic-adherent Staphylococcus epidermidis: Evidence for functional relation to intercellular adhesion,” Infect. Immunol, 60(5). 2048-2057. May 1992.
 
13]  McCoy, W.F., Bryers, J.D., Robbins, J. and Costerton, J.W, “Observations in fouling biofilm formation,” Can J Microbiol, 27 (9).910-917. Sep. 1981.
 
14]  Leung K.P., Crowel, T.D., Abercrombie, I.J., Molina, C.M., Bradshaw, C.J., Jensen, C.L., Luo, Q. and Thompson, G.A, “Control of oral biofilm formation by an antimicrobial decapeptide,” J Dent Res, 2005, 84(12). 1172-77. Dec. 2005.
 
15]  Chin, M.Y., Busscher, H.J., Evans, R., Noar, J. and Pratten, J, “Early biofilm formation and the effects of antimicrobial agent in orthodontic bonding materials in a parallel plate flow chamber,” Eur J Orthod, 28(1). 1-7. Feb.2006.
 
16]  Rieu, A., Briandet, R., Habiana, O., Garmyn, D., Guzzo, J. and Piveteau, P, “Listeria monocytogenes EGD-e biofilms: no mushroom but a network of knitted chains,” Appl Environ Microbiol, 74(14). 4491-4497. Jul. 2008.
 
17]  El-Azizi, M, “Enhancement of the in vitro activity of amphotericin B against the biofilms of non-albicans Candida spp. by rifampicin and doxycycline,” J Med Microbiol, 56(Pt5). 645-649. May 2007.
 
18]  Marrie, J. and Casterton, W, “Scanning and transmission electron microscopy of in situ bacterial colonization of intravenous and intraatrial catheters,” J Clin Microbiol, 19(5). 687-693. May 1984.
 
19]  Cengel, Y.A. and Cimbala, J.M, Fluid Mechanics: Fundamentals and Applications. 1st edition, McGraw Hill, New York, 2006, 322-325.
 
20]  McBain, A.J, “In vitro biofilm models: An overview,” Adv Appl Microbiol, 69. 99-132. 2009.
 
21]  Wenzel, R.P. and Edmond, M.B, “The impact of hospital-acquired bloodstream infections,” Emerg Infect Dis, 7(2). 174-177. March-Apr. 2001.
 
22]  Eggimann, P., Sax, H. and Pittet, D, “Catheter-related infections,” Microbes Infect, 6(11).1033-1042. Sep. 2004.
 
23]  Pittet, D, “Infection control and quality health care in the new millennium,” Am J Infect Control, 33(5). 258-267. Jun 2005.
 
24]  Mermel, L.A, “Prevention of intravascular catheter-related infections,” Ann Intern Med, 132(5). 391-402. March 2000.
 
25]  Darouiche, R.O, “Device-associated infections: a macroproblem that starts with microadherence,” Clin Infect Dis, 33(9). 1567-1572. Nov.2001.
 
26]  O’ Gara, J.P. and Hmphreys, H, “Staphylococcus epidermidis biofilms: Importance and implications,” J Med Microbiol, 2001, 50(7). 582-587. Jul. 2001.
 
27]  Huebner, J. and Goldmann, D.A, “Coagulase-negative staphylococci: role as pathogens,” Annu Rev Med, 50. 223-236. 1999.
 
28]  Maki, D.G. and Tambyah, P.A, “Engineering out the risk of infection with urinary catheters,” Emerg Infect Dis, 7(2). 1-6. March-Apr. 2001.
 
29]  Pappas, P.G., Rex, J.H., Sobel, J.D., Filler, S.G., Dismukes, D.E., Walsh, T.J. and Edwards, J.E, “Guidelines for treatment of candidiasis,” Clin Infect Dis, 38(2). 161-189. Jan. 2004.
 
30]  Crnich C.J. and Maki, D.G, “The promise of novel technology for the prevention of intravascular device-related bloodstream infection. I. Pathogenesis and short term devices,” Clin Infect Dis, 34(9) 1232-1242. May 2002.
 
31]  El-Azizi, M., Starks, S. and Khardori, N, “Interactions of Candida albicans with other Candida species and bacteria in the biofilms,” J Apl Microbiol, 96(5). 1067-1073. 2004.
 
32]  Busscher, H.J. and vand der Mei, H.C, “Use of flow chamber devices and image analysis methods to study microbial adhesion,” Methods Enzymol, 253. 455-477.1995
 
33]  Lynch, R.J. and Ten Cate, J.M, “Effect of calcium glycerophosphate on demineralization in an in vitro biofilm model,” Caries Res, 40(2). 142-147. 2006.
 
34]  Rosentritt, M., Hahnel, S., Groger, G., Muhlfriedel, B., Burgers, R. and Handel, G, “Adhesion of Streptococcus mutans to various dental materials in a laminar flow chamber system,” J Biomed Mater Res B Appl Biomater, 86(1). 36-44. Jul. 2008.
 
35]  Xie, Q., Li, J. and Zhau, X, “Anticaries effect of compounds extracted from Galla chinensis in a multispecies biofilm model,” Oral Microbial Immunol, 23(6). 459-465. Dec. 2008.
 
36]  Sjollema, J.H., Busscher, H.J. and Weer Kamp, A.H, “Deposition of oral Streptococci and polystyrene lattices onto glass in a parallel plate flow cell,” Biofouling, 1(2) 101-112. 1989
 
37]  Christersson, C.E, Glantz, P.O. and Baier, R.E, “Role of temperature and shear forces on microbial detachment,” Scand. J Den Res, 96(2). 91-98. Apr. 1988.
 
38]  Morisaki, H, “Measurement of the force necessary for removal of bacterial cells from aquartz plate,” Microbiol, 137. 2649-2655. 1991.
 
Show Less References

Article

Relationship between Temperature, Ph and Population of Selected Microbial Indicators during Anaerobic Digestion of Guinea Grass (Panicum Maximum)

1Department of Microbiology, Faculty of Biological Science, College of Natural and Applied Sciences, University of Port Harcourt, P.M.B. 5323 Port Harcourt, Nigeria


American Journal of Microbiological Research. 2015, 3(1), 14-24
DOI: 10.12691/ajmr-3-1-3
Copyright © 2015 Science and Education Publishing

Cite this paper:
Ogbonna. C. B., Berebon. D. P., Onwuegbu. E. K.. Relationship between Temperature, Ph and Population of Selected Microbial Indicators during Anaerobic Digestion of Guinea Grass (Panicum Maximum). American Journal of Microbiological Research. 2015; 3(1):14-24. doi: 10.12691/ajmr-3-1-3.

Correspondence to: Ogbonna.  C. B., Department of Microbiology, Faculty of Biological Science, College of Natural and Applied Sciences, University of Port Harcourt, P.M.B. 5323 Port Harcourt, Nigeria. Email: chukwukaogbonna@gmail.com

Abstract

In this study, the relationship between process temperature, process pH and population of selected microbial indicators during anaerobic digestion of guinea grass (Panicum maximum) at ambient condition was investigated. A one stage batch-type mesophilic anaerobic digestion system was configured using rumen fluid (RF) as inoculums (ADRF) and a low solid loading of approximately 7.0% total solid (TS). Physicochemical parameters such as process temperature (PTMRF), process pHRF and volatile fatty acid (VFARF) were monitored with time. Selected indicator microbial populations were monitored by standard cultural techniques based on metabolic capacity and oxygen sensitivity with respect to time. Result showed that average PTMRF increased from 27.5°C to 35.2°C, average process pHRF ranged from 6.5 to 7.9 and VFARF ranged from 1,080.00 mg/L to 4,800.33 mg/L with time. In terms of metabolic capacity and oxygen sensitivity, the populations of cellulolytic bacteria (CBRF), lactose and glucose fermenting (acidogenic) bacteria (LFBRF and GFBRF), propionate and ethanol oxidizing (acetogenic) bacteria (POBRF and EOBRF), acetate oxidizing methanogens (AOMRF), obligate anaerobic bacteria (OABRF) and total facultative bacteria (FAABRF) increased (about 10-fold) respectively with time. Correlation analysis showed positive relationships between the process temperature (PTMRF) and the population of selected microbial indicators with time. However, there were negative relationships between the process pHRF and the population of selected microbial indicators with time. Furthermore, there were positive relationships between the populations of selected microbial indicators with time. Rumen fluid significantly (P < 0.05) affected the dynamics of the process temperature (PTMRF) and process pHRF inside the ADRF system with time respectively. These kinds of relationships between biotic factors and between biotic and abiotic factors could be used to monitor the state of anaerobic digestion process with respect to time.

Keywords

References

[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[
[1]  Agdag, O.N. and Sponza, D.T. (2004). Effect of aeration on the performance of a simulated landfilling reactor stabilizing municipal solid waste. Journal of Environmental Science and Health Part A-Toxic and Hazardous Substances and Environmental Engineering, 39: 2955-2972.
 
[2]  Agdag, O.N., Sponza, D.T. (2007). Co-digestion of mixed industrial sludge with municipal solid wastes in anaerobic simulated landfilling bioreactors. J. Hazard. Mat. 140: 75-85.
 
[3]  Allison and Leek (1993). Rumen microbiology and fermentation in "Dukes’ Physiology of Domestic Animals" by Swenson & Reece, ed. (1993). "http://arbl.cvmbs.colostate.edu/," and others.
 
[4]  Aurora, S.P. (1983). Microbial Digestion in Ruminants. Indian Council of Agricultural Research, New Delhi.
 
[5]  Azeem, K., Muhammad, A., Muzammil, A., Tariq, M., and Lorna, D. (2011). The anaerobic digestion of solid organic waste. Waste Management, 31: 1737-1744.
 
Show More References
6]  Bouallagui, H., Rachdi, B., Gannoun, H., Hamdi, M. (2009b). Mesophilic and thermophilic anaerobic co-digestion of abattoir wastewater and fruit and vegetable waste in anaerobic sequencing batch reactors. Biodegradation, 20: 401-409.
 
7]  Briski, F., Vukovic, M., Papa, K., Gomzi, Z., Domanovac, T. (2007). Modelling of compositing of food waste in a column reactor. Chem. Pap. 61: 24-29.
 
8]  Bryant, M.P. (1972). Commentary on Hungate technique for culture of anaerobic bacteria. American Journal of Clinical Nutritions, 25: 1324-1327.
 
9]  Buchauer, K. (1998). A Comparison of Two Simple Titration Procedures to Determine the Concentration of Volatile Fatty Acids in Influents of Waste Water and Sludge Treatment Procedures. Water SA, 24 (1): 49-56.
 
10]  Budiyono, Widiasa, Seno Johari, Sunaro, (2009). Increasing biogas production rate from cattle manure using rumen fluid as inoculums. International Journal of Basic and Applied Sciences, 10: 1.
 
11]  Chanakya, H.N., and Sreesha, M. (2012). Anaerobic digestion for bioenergy from Agro-Residues and other solid wastes-An over view of science, technology and sustainability. Journal of the Indian Institute of Science, 92: 1.
 
12]  Chanakya, H.N., Ramachandra, T.V., and Vijayachamundeeswari, M. (2007). Resource recovery potential from secondary components of segregated municipal solid wastes. Environ. Monitoring Assessment, 135: 119-127.
 
13]  Claudia, J.S.L., Marisol, V.M., Mariela, C.A., and Edgar, F.C.M (2009). Microbiological characterization and specific methanogenic activity of anaerobe sludge used in urban solid waste treatment. Waste Management, 29: 704-711.
 
14]  Dasonville, F. and Renault, P. (2002). Interactions between microbial processes and geochemical transformations under anaerobic conditions: a review. Agronomie, 22: 51-68.
 
15]  Dela-Rubia, M.A., Perez, M., Romero, L.I., Sales, D., (2002). Anaerobic mesophilic and thermophilic municipal sludge digestion. Chem. Biochem. Eng. Qual. 16: 119-124.
 
16]  Dong, L., Zhenhong, Y., Yongming, S., Xiaoying, K., and Yu, Z. (2009). Hydrogen production characteristics of organic fraction of municipal solid wastes by anaerobic mixed culture fermentation. Int. J. Hydr. Energy, 34: 812-820.
 
17]  Drake, H. L., Gössner, A., and Daniel, S. (2008). Old acetogens, new light.Annual New York Academy of Sciences, 1125: 100-128.
 
18]  El-Mashad, H.M., Wilko, K.P., Loon, V., Zeeman, G. (2003). A model of solar energy utilisation in the anaerobic digestion of cattle manure. Biosyst. Eng. 84: 231-238.
 
19]  Fernandez, J., Perez, M., Romero, L.I. (2008). Effect of substrate concentration on dry mesophilic anaerobic digestion of organic fraction of municipal solid waste (OFMSW). Bioresour. Technol. 99: 6075-6080.
 
20]  Fezzani, B. and Cheikh, R.B. (2010). Two-phase anaerobic co-digestion of olive mill wastes in semi-continuous digesters at mesophilic temperature. Bioresour. Technol. 101: 1628-1634.
 
21]  Forster-Carneiro, T., Pérez, M., Romero, L.I., and Sales, D. (2007). Dry-thermophilic anaerobic digestion of organic fraction of the municipal solid waste: focusing on the inoculum sources. Bioresources and Technology, 98: 3195-3203.
 
22]  Gerardi, M. H. (2003). The microbiology of anaerobic digesters. In: Wastewater microbiology series, John Wiley & Sons Inc. New Jersey, USA.
 
23]  Guermoud, N., Ouagjnia, F., Avdelmalek, F., Taleb, F., and Addou, A. (2009). Municipal solid waste in Mostagnem city (Western Algeria). Waste Management, 29: 896-902.
 
24]  Hickey, R. F., Vanderwielen, J., and Switzenbaum, M.S. (1987). “The Effects of Organic Toxicants on Methane Production and Hydrogen Gas Levels during the Anaerobic Digestion of Waste Activated Sludge.” Water Research, 21 (11): 1417-1427.
 
25]  Huber, H., Thomm, M., Konig, H., Thies, G., Stetter, K.O. (1982). Methanococeus thermolithotrophicus, a novel thermophilic lithotrophic methanogen. Arch. Microbiol. 132: 47-50.
 
26]  Ike, M., Inoue, D., Miyano, T., Liu, T.T., Sei, K., Soda, S., and Kadoshin, S. (2010). Microbial population dynamics during startup of a full-scale anaerobic digester treating industrial food waste in Kyoto eco-energy project. Bioresource Technology, 101: 3952-3957.
 
27]  Kashyap, D.R., Dadhich, K.S., Sharma, S.K. (2003). Biomethanation under psychrophilic conditions: a review. Bioresour. Technol. 87: 147-153.
 
28]  Kim, J., Park, C., Kim, T.H., Lee, M., Kim, S., Kim, S.W., Lee, J. (2003). Effects of various pretreatments for enhanced anaerobic digestion with waste activated sludge. J. Biosci. Bioeng. 95: 271-275.
 
29]  Kim, J.K., Nhat, L., Chun, Y.N., and Kim, S.W. (2008). Hydrogen production condition from food waste by dark fermentation with Clostridium beijerinckii KCTC 1785. Journal of Biotechnology and Bioprocess Engineering, 13: 499-504.
 
30]  Kim, J.K., Oh, B.R., Chun, Y.N., Kim, S.W. (2006). Effects of temperature and hydraulic retention time on anaerobic digestion of food waste. J. Biosci. Bioeng. 102: 328-332.
 
31]  Labat, M. and Garcia, J.L. (1986). Study on the development of methanogenic microflora during anaerobic digestion of sugar beet pulp. Journal of Applied Microbiology and Biotechnology, 25: 163-168.
 
32]  Labib, F., Ferguson, J.F., Benjamin, M.M., Merigh, M., and Ricker, N.L. (1992). “Anaerobic Butyrate Degradation in a Fluidized-Bed Reactor: Effects of Increased Concentrations of H2 and Acetate.” Environmental Science and Technology, 26 (2): 369-376.
 
33]  Lee, D.H., Behera, S.K., Kim, J., Park, H.S. (2009b). Methane production potential of leachate generated from Korean food waste recycling facilities: a lab scale study. Waste Manage.29: 876-882.
 
34]  Levén, L., Eriksson, A., and Schnürer, A. (2007). Effect of process temperature on bacterial and archaeal communities in two methanogenic bioreactors treating organic household waste. FEMS Microbiology Ecology, 59: 683-693.
 
35]  Liu, C., Yuan, X., Zeng, G., Li, W., Li, J. (2008). Prediction of methane yield at optimum pH for anaerobic digestion of organic fraction of municipal solid waste. Bioresour. Technol. 99: 882-888.
 
36]  Liu, Y. and Whitman, W.B. (2008). Metabolic, phylogenetic, and ecological diversity of the methanogenic archaea. Annual New York Academy of Sciences, 1125: 171-189.
 
37]  Ljupka, A. (2010). Anaerobic digestion of food waste: Current status, problems and an alternative product. An M.S. Thesis: Submitted to the Department of Earth and Environmental Engineering, Columbia University.
 
38]  Lopes, W.S., Leite, V.D., and Prasad, S. (2004). Influence of inoculum on performance of anaerobic reactors for treating municipal solid waste. Bioresources and Technology, 94: 261-266.
 
39]  Ogbonna, C. B., Ibiene, A. A. and Stanley, H. O. (2014). Microbial population dynamics during anaerobic digestion of guinea grass (Panicum maximum). Journal of Applied and Environmental Microbiology, 2 (6): 294-302.
 
40]  Parkin, G. F. and Owen, W.F. (1986). “Fundamentals of Anaerobic Digestion of Wastewater Sludges.” Journal of Environmental Engineering, 24 (8): 867-920.
 
41]  Preeti Rao, P., D. Shivaraj and G. Seenayya (1993). “Improvement of methanogenesis from cow dung and poultry litter waste digesters by addition of iron”. Indian Journal of Microbiology, 33: 185-189.
 
42]  Ramasamy, K., Nagamani, B., and Kalaichelvan, G. (1990). In 31st Annual Conference of AMI held at TNAU, Coimbatore, pp: 96.
 
43]  Riau, V., De la Rubia, M.A., Pérez, M. (2010). Temperature-phased anaerobic digestion (TPAD) to obtain class A biosolids: a semi-continuous study. Bioresour. Technol. 101: 2706-2712.
 
44]  Schink, B. (1997). Energetics of syntrophic cooperation in methanogenic degradation. Microbiological Molecular Biological Review, 61: 262-280.
 
45]  Schnurer, A. and Jarvis, A. (2010). Microbiological handbook for biogas plants. Swedish Gas Centre Report 207, pp: 13-138.
 
46]  Sousa, D. Z., Pereira, A.M., Stams, A.J.M., Alves, M.M., and Smith, H. (2007). Microbial communities involved in anaerobic degradation of unsaturated long-chain fatty acids. Applied and Environmental Microbiology, 73: 1054-1064.
 
47]  Susan, B.L. (1995). Cellulose degradation in anaerobic environments. Annual Reviews of Microbiology, 49: 399-426.
 
48]  Svahn, J. (2006). Energioptimering av biogasproduktion-hur primärenergibehov till biogasanläggning kan minskas med energiåtervinning och isolering. Report Energiteknik, Umeå University.
 
49]  Trzcinski, A.P., Stuckey, D.C. (2010). Treatment of municipal solid waste leachate using a submerged anaerobic membrane bioreactor at mesophilic and psychrophilic temperatures: analysis of recalcitrants in the permeate using GC-MS. Water Res. 44: 671-680.
 
50]  Uzodinma, E.O. and Ofoefule, A.U. (2009). Biogas production from blends of field grass (Panicum maximum) with some animal wastes. International Journal of Physical Sciences, 4 (2): 91-95.
 
51]  Ward, A.J., Hobbs, P.J., Holliman, P.J., Jones, D.L., 2008. Optimization of the anaerobic digestion of agricultural resources. Bioresour. Technol. 99: 7928-7940.
 
52]  Yang, S.T. and Okos, M.R. (1987). Kinetic study and mathematical modeling of methanogenesis of acetate using pure cultures of methanogens. Biotechnol. Bioeng. 30: 661-667.
 
53]  Yassar, H.F. (2011). Feasibility of compact, high-rate anaerobic digesters for biogas generation at small dairy farms. NYSERDA 9888, Report 11-02. Albany, NY www.nyserda.org.
 
54]  Zhou, Z. H., Liu, F.H., and Wang, S.B. (2009). The structure of bacterial and archaeal community in a biogas digester as revealed by denaturation gradient gel electrophoresis and 16S rDNA sequencing analysis. Journal of Applied Microbiology, 106: 952-966.
 
55]  Zinder, S. H. (1984). Microbiology of anaerobic conversion of organic wastes to methane: recent developments. ASM News, 50: 294-298.
 
56]  Zinder, S.H. (1993). Physiological ecology of methanogenesis. In Methanogenesis: Ecology, Physiology, Biochemistry and Genetics (Ferry, J.G., ed.). New York, Chapman and Hall, pp: 128-206.
 
Show Less References

Article

The Effect of the Petroleum Ether Extracts from Mangosteen Pericarp (Garcinia mangostana L.) on Interferon-gammaand, Interleukin-12 Activities in AlbinoWistar Rats (Rattus norvegicus) Infected with Mycobacterium tuberculosis

1Biology Study Programm, Faculty of Mathematic and Sciences, Pattimura University, Ambon, Indonesia

2Department of Internal Medicine, Faculty of Medicine, Hasanudin University, Makassar, Indonesia

3Department of Microbiology, Faculty of Medicine, Mulawarman University, Samarinda, Indonesia

4Molecular Biology and Immunology Laboratory for Infectious Diseases, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia


American Journal of Microbiological Research. 2015, 3(1), 8-13
DOI: 10.12691/ajmr-3-1-2
Copyright © 2015 Science and Education Publishing

Cite this paper:
Martha Kaihena, Syamsu, Yadi Yasir, Mochammad Hatta. The Effect of the Petroleum Ether Extracts from Mangosteen Pericarp (Garcinia mangostana L.) on Interferon-gammaand, Interleukin-12 Activities in AlbinoWistar Rats (Rattus norvegicus) Infected with Mycobacterium tuberculosis. American Journal of Microbiological Research. 2015; 3(1):8-13. doi: 10.12691/ajmr-3-1-2.

Correspondence to: Mochammad  Hatta, Molecular Biology and Immunology Laboratory for Infectious Diseases, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia. Email: hattaram@indosat.net.id

Abstract

Background. Garcinia mangostana L(GML) pericarp extract is known to contain active substances called Xanthones (α, β and γ Mangosteens) which is the biggest derivative and has strong antioxidant effects. This substance also has antiinflammatory, antilipid, anticancer, antibacteria and antituberculosis effects. However, its mechanism is still unclear. Mycobacterium tuberculosis (M. tuberculosis) invasion into the lungs through the respiratory tract can cause severe infection. The body has an immune system which controls infection by eliminating germs to ease the burden of infection. Interferon gamma (IFN- γ) and Interleukin 12 (IL-12) acts as positive feedback in stimulating macrophages to kill M. tuberculosis. During this process, oxidative compounds (ROI,RNI,NO) that plays an important role in the phagolysosome fusion process are produced. Not only does the consumption of GML pericarp extract as an antioxidant becomes the immunomodulator to enhance the immune’s activities, it also functions as an antioxidant that can neutralize the oxidative compounds produced by the immune system. The aim of this study was to determine the effect of EPEBh GML on IFN-γ and IL-12 secretion activities in mice infected with M. tuberculosis. Materials and method. This study used 30 Wistar rats, 150-200g of weight and 8-10 weeks old. Rats were randomly divided into 6 groups each consisting of 5 rats, including the negative control (without infection and without EPEKBh GML intervention) and a positive control (rats were infected with M.tb H37Rv at a dose of 106cfuas much as 0.2 ml through the trachea for 6 weeks). Once infected, the rats were then intervened with EPEKBhGML 30, 60, 120 dose and 180 mg/kg bodyweigh/day for 1 month. Afterward the rats were necropsied and dissected for the blood to be taken directly from the heart. Levels of IFN-γ and IL-12 were analyzed using the ELISA method. Data were then analyzed using One-Way ANOVAtest followed by Post-Hoc test (LSD), a significant P <0.05, to assess the comparison between groups. Results. Results show that EPEKBh GML significantly affect the rise of IFN-γ levels, with a P value 0,000<0,05 and IL-12, with a P value of 0,045 <0,05. Conclusion. EPEKBh GML was effective in increasing the activity of IFN-γ and IL-12 and the most effective dose to increase IFN-γ and IL-12activity was 120 mg/kgbody weight/day. Also, increasing the dose to a higher dosage had no effect on IFN-γ and IL-12 activity, in fact it tended to decline.This results need to further study to understand what the reason.

Keywords

References

[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[
[1]  WHO: Global Tuberculosis Report 2013. WHO Press 2013: http://www.who.int/tb/publications/global_report/en/.
 
[2]  Zumla A, Raviglione M, Hafner R, von Reyn CF. Tuberculosis. N Engl J Med. 2013, 368:745-55.
 
[3]  Smith I. Mycobacterium tuberculosis Pathogenesis and Molecular Determinants of Virulence. Clinical Microbiology Reviews 2003, 16(3): 463-496.
 
[4]  Subagyo A., T.Y Aditama., Sutoyo D.K. dan L.G Partakusuma. Pemeriksaan Interferon-gamma Dalam Darahuntuk DeteksiInfeksi Tuberkulosis, JTI 3(2). 6-15.
 
[5]  Schluger NW,Ro WN. The Host Immune To Tuberculosis. AmJRespir; Crite Care Med 1998, Vol157. pp 79-691.
 
Show More References
6]  Gouzy A, Larrouy-Maumus G, Bottai D, Levillain F, Dumas A, et al. Mycobacterium tuberculosis Exploits Asparagine to Assimilate Nitrogen and Resist Acid Stress during Infection. PLoSPathog. 2014, 10(2): e1003928.
 
7]  Lange C, Abubakar I, Alffenaar J-WC, et al. Management of patients with multidrug-resistant/extensively drug-resistant tuberculosis in Europe: a TBNET consensus statement. The European Respiratory Journal 2014; 44(1): 23-63.
 
8]  Gaude GS, Hattiholli J, Kumar P. Risk factors and drug-resistance patterns among pulmonary tuberculosis patients in northern Karnataka region, India. Nigerian Medical Journal: Journal of the Nigeria Medical Association 2014, 55(4):327-332.
 
9]  Mendez AP., RaviglioneMC.,Laszlo A., Binkin N., Rieder HL., Bustreo F., Cohn DL., Weezenbeek CSBI., Kim SJ., Chaulet P., Nun P., Global surveillance for antituberculosis-drug resistance. 1994-1997. NEJM 1998, 338: 1641-9.
 
10]  Indonesia Health Department,Guideline for Tuberculosis management. 8th Edition, Jakarta. Indonesia 2002.
 
11]  Muchtar,A. Farmakologi Obat Antituberkulosis (OAT) Sekunder.JTI 2006, 3(2): 24-25.
 
12]  WHO: Drug-Resistant Tb Surveillance & Response Supplement Global Tuberculosis Report 2014. WHO Press 2014: http://who.int/tb/publications/global_report/gtbr14_supplement_web_v3.pdf?ua=1.
 
13]  vanCrevel R, Ottenhoff THM, van der Meer JWM. Innate immunity to Mycobacterium tuberculosis. Clin. Microbiol. Rev. 2002, 15: 294-309.
 
14]  Arora A, Nadkarni B, Dev G, Chattopadhya D, Jain AK, Tuli SM, Kumar S.The use of immunomodulators as an adjunct to antituberculous chemotherapy in non-responsive patients with osteo-articular tuberculosis. J Bone Joint Surg Br. 2006 Feb, 88(2): 264-9.
 
15]  Jing J. Wang a,b, Qing H. Shi a,c, Wei Zhang a,b, Barbara J.S. Sanderson. Anti-skin cancer properties of phenolic-rich extract from the pericarpofmangosteen (Garciniamangostana Linn.). Food and Chemical Toxicology. 2012, 50:3004-3013.
 
16]  Wang JJ, Zhang W, Sanderson BJS. Altered mRNA Expression Related to the Apoptotic Effect of Three Xanthones on Human Melanoma SK-MEL-28 Cell Line. BioMed Research International 2013, 2013:715603.
 
17]  Jing J. Wang, Barbara J.S. Sanderson, Wei Zhang. Cytotoxic effect of xanthones from pericarp of the tropical fruit mangosteen (Garciniamangostana Linn.) on human melanoma cells.Food and Chemical Toxicology, Volume 49, Issue 9, September 2011, Pages 2385-2391
 
18]  Marcin Barański, Dominika Średnicka-Tober, Nikolaos Volakakis,, et al. Higher antioxidant and lower cadmium concentrations and lower incidence of pesticide residues in organically grown crops: a systematic literature review and meta-analyses. Br J Nutr. 2014; 112(5): 794-811.
 
19]  Chomnawang MT, Surassmo S, Nukoolkarn VS, Gritsanapan W. Effect of Garciniamangostanaon inflammation caused by Propionibacteriumacnes. Fitoterapia 2007, 78: 401-8.
 
20]  Supiyanty W, Wulansari ED, Kusmita L. Ujiaktivitasantioksidandanpenebtuankandunganantosianin total kulitbuahmanggis (Garciniamangostana L.) Sekolah Tinggi Ilmu Farmasi Yayasan Pharmasi Semarang. Majalah Obat Tradisional. 2010, 15 (2): 64-70.
 
21]  Suksamrarn S., Panseeta P., Kunchanawatta S., Distaporn I., Ruktasing S., Suksamrarn A. Ceanothane–and Lupane-Type Triterpenes with Antiplasmodial and Antimycobacterial Activities with Antiplasmodial and from Ziziphuscambodiana. Chem. Pharm. Bull. 2006, 54(4)535 – 537.
 
22]  Dahlan MS.Statistic for health and medicine (in Indonesia).SPSS : 5th edition. Jakarta:Salemba Medika, Indonesia 2012.
 
23]  The AVMA Guidelines for the Euthanasia of Animals: 2013 Edition: https://www.avma.org/KB/Policies/Documents/euthanasia.pdf.
 
24]  Peper A. Aspects of the Relationship Between Drug Dose and Drug Effect. Dose-Response 2009, 7(2): 172-192.
 
25]  A. Gurib-Fakim. Review: Medicinal plants: Traditions of yesterday and drugs of tomorrow. Molecular Aspects of Medicine 2006, 1-93.
 
26]  Susanto M., Zulfian, B. Kurniawan, A. Tjiptaningrum, Effects of Garciniamangostana L. against AST and ALT activity in Rattusnovergicus induced by Isoniazid (in Indonesia). Medical Faculty Lampung University journal. 2013. 23: 378-381.
 
27]  Pasaribu F, P.Sitorus S.Bahri, Effects of Garcinia Mangostana L.extraction in decreasing level glucosa in blood (in Indonesia). Journal of Fakultas Farmasi USU. 2012. 12: 142-149.
 
28]  Darwich L, Coma G, Peña R, et al. Secretion of interferon-γ by human macrophages demonstrated at the single-cell level after costimulation with interleukin (IL)-12 plus IL-18. Immunology 2009, 126(3): 386-393.
 
29]  Michel Denis. Interferon-gamma-treated murine macrophages inhibit growth of tubercle bacilli via the generation of reactive nitrogen intermediates. Cellular Immunology, Volume 132, Issue 1, January 1991, Pages 150-157.
 
30]  Christian Bogdan, Martin Röllinghoff, Andreas Diefenbach. Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity. Current Opinion in Immunology, Volume 12, Issue 1, 1 February 2000, Pages 64-76.
 
31]  Kubota K. Innate IFN-γ production by subsets of natural killer cells, natural killer T cells and γδ T cells in response to dying bacterial-infected macrophages. Scand J Immunol 2010, 71: 199-20910.
 
32]  Janis E. Wigginton and Denise Kirschner. A Model to Predict Cell-Mediated Immune Regulatory Mechanisms During Human Infection with Mycobacterium tuberculosis. J Immunol. 2001, 166: 1951-1967.
 
33]  Emily Gwyer Findlay and Tracy Hussell, “Macrophage-Mediated Inflammation and Disease: A Focus on the Lung,” Mediators of Inflammation 2012, Article ID 140937, 6 pages, 2012.
 
34]  Tostman A, Boeree MJ, Aarnouts RE, de Lange WC, Van der Ven AJAM, and Dekhuijen R.. Antituberculosis drug-induced hepatotoxicity: Concise up-to-date review. Journal of Gastroenterology and Hepatology 2007.
 
35]  Akiibinu MO., Ogunyemi EO, Arinola OG, AdenaikeAf, and Adegoke OD. Level of Oxidatif Metabolites Antioxidants and Neopterin in Nigerian Pulmonary Tuberculosis PatientsEur.J.Gen.Med. 2011, 5(4): 208-211.
 
36]  Venketaraman V, Dayaram YK, Talaue MT, dan Connell ND. 2005. Glutathione and Nitrosoglutathione in macrophage defense against M. tuberculosis. Infect Immunity.
 
37]  Guerra C, Johal K, Morris D, et al. Control of Mycobacterium tuberculosis growth by activated natural killer cells. Clinical and Experimental Immunology 2012, 168(1): 142-152.
 
Show Less References

Article

Effect of Some Non steroidal Anti-Inflammatory Drugs on Growth, Adherence and Mature Biofilms of Candida spp.

1Undergraduate student, faculty of pharmacy, Minia university

2Undergraduate student, Faculty of science, Minia university

3Demonstrator, Department of Microbiology, Faculty of Pharmacy, Minia university

4A researcher, Department of Microbiology, Faculty of Pharmacy, Minia university

5Lecturer of Microbiology, Department of Microbiology, Faculty of Pharmacy, Minia university


American Journal of Microbiological Research. 2015, 3(1), 1-7
DOI: 10.12691/ajmr-3-1-1
Copyright © 2015 Science and Education Publishing

Cite this paper:
Ahmad Ashraf, Fatma Yousri, Nora Taha, Omar Abd El-Waly, Abd El-Kareem Ramadan, Esraa Ismail, Reham Hamada, Mohamed Khalaf, Mohamed Refaee, Sameh Ali, Abobakr Madyn, Rehab Mahmoud Abd El-Baky. Effect of Some Non steroidal Anti-Inflammatory Drugs on Growth, Adherence and Mature Biofilms of Candida spp.. American Journal of Microbiological Research. 2015; 3(1):1-7. doi: 10.12691/ajmr-3-1-1.

Correspondence to: Rehab  Mahmoud Abd El-Baky, Lecturer of Microbiology, Department of Microbiology, Faculty of Pharmacy, Minia university. Email: dr_rehab010@yahoo.com

Abstract

Candida spp. are the most common cause of fungal diseases and the fourth commonest cause of nosocomial invasive infections which are considered in many cases as life threatening. Among Candida spp., C. albicans is the most common cause of many fungal diseases, but non-albicans spp. infections are in increase. Non-steroidal anti-inflammatory drugs have previously been shown to have antifungal activity. In this study we determine the antifungal activity of the tested NSAIDs using agar well diffusion method, their effect on the dimorphic transition of C. albicans by testing their ability to form germ tube in the presence of human serum. Determining the effect of NSAIDs on the adherence to plastic surfaces and on the mature biofilms formed by the tested Candida spp.. The results indicated that Sodium Diclofenac showed lower MIC against C. albicans and C. glabrata while Ibuprofen had lower MIC against C. krusei. upon examining the effect of Diclofenac sodium, Ibuprofen and ketoprofen on biofilm formed on polyurethane segments by Scanning electron microscope (SEM), a damage to membranes of the tested species was observed. Sodium Diclofenac showed the highest inhibitory effect on the adherence (51.1-76.9% at MIC and 56.6-83.3% at 2XMIC) of C. albicans and C. glabrata but Ibuprofen showed a higher inhibitory effect against the adherence of C. krusei. For mature biofilms, the highest disruptive effect on mature biofilms formed by all tested Candida Spp. (37.72-59.29% at MIC and 42.68-63.06% at 2XMIC) was observed by Diclofenac sodium. Sodium Diclofenac inhibited dimorphic transition of C. albicans but a decrease in germ tube formation was shown by others. In conclusion, the tested drugs showed antifungal, anti-adherent and anti-biofilm activity that make them useful in the treatment of fungal infection and the prevention of biofilm formation on the surface of medical devices.

Keywords

References

[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[
[1]  Douglas JL, Cobbs CG. Prosthetic valve endocarditis. In: Kaye D, Ed. Infective endocarditis. 2d ed. New York: Raven Press 1992; 375-96.
 
[2]  Tunney MM, Patrick S, Curran MD, et al. Detection of prosthetic joint biofilm infection using immunological and molecular techniques. Methods Enzymol 1999; 310: 566-76.
 
[3]  Raad I, Costerton W, Sabharwal U, Sacilowski M, Anaissie E, Bodey GP. Ultrastructural analysis of indwelling vascular catheters: a quantitative relationship between luminal colonization and duration of placement. J Infect Dis 1993; 168 (2): 400-7.
 
[4]  Ramage G, Martínez JP, López-Ribot JL. Candida biofilms on implanted biomaterials: a clinically significant problem. FEMS Yeast Res 2006; 6 (7): 979-86.
 
[5]  Seneviratne CJ, Jin L, Samaranayake LP. Biofilm lifestyle of Candida: a mini review. Oral Dis 2008, 14 (7): 582-90.
 
Show More References
6]  LaFleur M, Kumamoto CA and Lewis K. Candida albicans biofilms produce antifungal-tolerant persister cells. Antimicrob Agents Chemother 2006, 50: 3839-46.
 
7]  Characklis W G, and Wilderer P A. Structure and function of biofilms. Wiley, Chichester, United Kingdom. 1989.
 
8]  Costerton, J. W., K. J. Cheng, G. G. Geesey, T. I. Ladd, J. C. Nickel, M. Dasgupta, and T. J. Marrie. Bacterial biofilms in nature and disease. Annu. Rev. Microbiol. 1987, 41: 435-464.
 
9]  Dougherty S H. Pathobiology of infection in prosthetic devices. Rev. Infect. Dis. 1988, 10: 1102-1117.
 
10]  Elliott T S J. Intravascular device infections. J. Med. Microbiol. 1988, 27: 161-167.
 
11]  Goldmann D A, and Pier G B. Pathogenesis of infections related to intravascular catheterization. Clin. Microbiol. Rev. 1993, 6: 176-192.
 
12]  Gristina AG. Biomaterial centered infection: microbial adhesion versus tissue integration. Science 1987, 237: 1588-1595.
 
13]  Melo L F, Bott T R, Fletcher M, and Capdeville B. Biofilms-science and technology. Kluwer Academic Publishers, Dordrecht, The Netherlands 1992.
 
14]  Brown M R W, and Gilbert P. Sensitivity of biofilms to antimicrobial agents. J Appl Bacteriol Symp 1993, 74:87S-97S.
 
15]  Cox G M, and Perfect J R. Fungal infections. Curr Opin Infect Dis 1993, 6: 422-426.
 
16]  Wey S B, Mori M, and Pfaller M A. Hospital-acquired candidemia. The attributable mortality and excess length of stay. Arch Intern Med 1988, 148: 2642-2645.
 
17]  Maki D G. Pathogenesis, prevention and management of infections due to intravascular devices used for infusion therapy, 1989, 161-177. In A. L. Bisno and F. A. Waldvogel (ed.), Infections associated with indwelling medical devices. American Society for Microbiology, Washington, D.C.
 
18]  Odds FC. Candida and candidosis, 2nd ed. Bailliere Tindall, London. 1988
 
19]  Alem MA, Douglas LJ. Effects of aspirin and other nonsteroidal anti-inflammatory drugs on biofilms and planktonic cells of Candida albicans. Antimicrob Agents Chemother 2004, 48: 41-7.
 
20]  Dannhardt G, Kiefer W. Cyclooxygenase inhibitors-current status and future prospects. Eur J Med Chem 2001, 36: 109-26.
 
21]  Alem MA, Douglas LJ. Prostaglandin production during growth of Candida albicans biofilms. J Med Microbiol 2005, 54: 1001-5.
 
22]  Erb-Downward JR, Noverr MC. Characterization of prostaglandin E2 production by Candida albicans. Infect Immun 2007, 75: 3498-505.
 
23]  Pina-Vaz C, Rodrigues AG, Costa-de-Oliveira S, Ricardo E and Ma°rdh P. Potent synergic effect between ibuprofen and azoles on Candida resulting from blockade of efflux pumps as determined by FUN-1 staining and flow cytometry. J Antimicrob Chemother 2005 56: 678-685.
 
24]  Benson HC. Microbiological Application: Laboratory Manual in General Microbiology, 11th ed., McGram-Hill Higher Education, Sanfrancisco, 2002, pp.168.
 
25]  Christensen GD, Simpson WA, Younger J A, Baddour L M, Barrett F F, Melton D M, et al. Adherence of coagulase negative Staphylococci to plastic tissue cultures: a quantitative model for the adherence of Staphylococci to medical devices. J Clin Microbiol 1985, 22: 996-1006.
 
26]  O'Toole AG and Kolter R. Initiation of biofilm formation in Pseudomonas fluorescence WCS365 proceeds via multiple, convergent signaling pathways: a genetic analysis. Molecular microbiology 1998, 28: 449.
 
27]  Bennet JV, Brodie JL, Benner JL, Kirby WMM. “Simplified accurate method for antibiotic assay of clinical specimens. Applied Microbiology 1966, 14: 2170-2177.
 
28]  Negero Gemeda, Kelbessa Urga, Ashenif Tadele, Hirut Lemma, Daniel Melaku, Kissi Mudie. “Antimicrobial Activity of Topical Formulation Containing Eugenia caryophyllata L. (Krunfud) and Myritus communis L. (Ades) Essential Oils on Selected Skin Disease Causing Microorganisms.” Ethiop. J. Health Sci. 2008, 18(3): 101-107.
 
29]  Esimone C O, Adiukwu M U, Okonta J M, “Preliminary Antimicrobial Screening of the Ethanolic Extract from the Lichen Usnea subfloridans L,”. IJPRD 1998, 3: 99-102.
 
30]  Liu H, Kohler J, Fink GR. Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science (New York, NY) 1994, 266: 1723-6.
 
31]  Xiaogang L, Zhun Y and Jianping X. Quantitative variation of biofilms among strains in natural populations of Candida albicans. Microbiology 2003, 149: 353-362.
 
32]  Soboh F, Khoury AE, Zamboni AC, Davidson D, Mittelman MW. Effects of ciprofloxacin and protamine sulfate combinations against catheter-associated Pseudomonas aeruginosa biofilms. Antimicrob. Agents Chemother 1995, 39: 1281-1286.
 
33]  Jacqueline M, Achkar, Bettina C. Candidal Infections of the Genitourinary tract. Clin. Microbiol. Rev. 2010, 23(2):253-72.
 
34]  Mohandas V, Ballal M. Distribution of Candida Species in Different Clinical Samples and Their Virulence: Biofilm Formation, Proteinase and Phospholipase Production: A Study on Hospitalized Patients in Southern India. J. Glob. Infect. Dis. 2011, 3 (1): 4-8.
 
35]  Seneviratne CJ, Jin L, Samaranayeke LP. Biofilm lifestyle of Candida: A mini review. Oral. Dis. 2008, 14: 582-590.
 
36]  Aparna MS, Yadav S. Biofilms: Microbes and Disease. The Braz J. Infect. Dis. 2008, 12: 526-530.
 
37]  Cederlund H, Màrdh P-A. Antibacterial activities of N-acetylcysteine and some non steroidal anti-inflammatory druga. J. Antimicrob chemother 1993 32: 903-904.
 
38]  Sanyal AK, Roy D, Chowdhury B, Banerjee AB. Ibuprofen, a unique anti-inflammatory compound with antifungal a activity against dermatophytes. Lett Appl Microbial 1993, 109-111.
 
39]  Scott E M, Tariq VN, McCrory R M. Demonsteration of synergy with fluconazole and either ibuprofen, sodium salicylate or propylparaben against C. albicans in-vitro. Antimicrob. Agents Chemother 1995, 39: 2610-2614.
 
40]  Alem MA, Douglas LJ. Effects of aspirin and other nonsteroidal anti-inflammatory drugs on biofilms and planktonic cells of Candida albicans. Antimicrob Agents Chemother 2004, 48:41-7.
 
41]  Ghalehnoo Z R, Rashki A, Najimi M, Dominguez A. The role of Sodium Diclofenacin the dimorphic transition in Candida albicans Microbial Pathogenesis 2010, 48: 110-115
 
42]  Bink, A, Kucharíková S, Neirinck B, Vleugels J, Dijck P V, Cammue B P. A. and Thevissen K. The Non-steroidal Anti-inflammatory Drug Diclofenac Potentiates the In Vivo Activity of Caspofungin Against Candida albicans Biofilms JID 2012:206.
 
43]  Alem MA, Douglas LJ. Prostaglandin production during growth of Candida albicans biofilms. J Med Microbiol 2005, 54:1001-5.
 
44]  Pina-Vaz C, Sansonetty F, Rodrigues A et al. Antifungal activity of ibuprofen alone and in combination with fluconazole against Candida species. J Med Microbiol 2000, 49: 831-40.
 
45]  Chowdhury B, Mukhopadhyay S. Ketoprofen, a non-steroidal, anti-inflammatory drug, has antimicrobial activity against dermatophytes Medical Science Research. 1997, 25: 109-110.
 
46]   Samaranayake Y H, Samaranayake LP. Candida krusei: biology, epidemiology, Pathogenicity and clinical manifestations of an emerging pathogen. J. Med. Microbiol. 1994, 41. 295-310.
 
47]  Abdelmegeed E and Shaaban M I, Cyclooxygenase inhibitors reduce biofilm formation and yeast-hypha conversion of fluconazole resistant Candida albicans. J microbiol 2013, 51: 598-604.
 
Show Less References